Positive reference product using human ADRB1 gene 1165 locus GG type as template
A reference product and gene technology, applied in the field of molecular biology, to achieve the effect of solving quality inspection problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0020] Example: A positive reference product based on the GG type at position 1165 of the human ADRB1 gene as a template
[0021] The GG type positive reference product is a reagent with a base sequence as the main component. The base sequence contains a human ADRB1 gene fragment, and the human ADRB1 gene fragment is 5'-GGCGGGCCCTCGCGCCTCGTGGCCCTGCGCGAGCAGAAGGCGCTCAGGACGCTGGGCATCATCATGGGCGTCTTCACGCT G TGCTGGCTGCCCTTCTTCCTGGCCAACGTGGTGAAGGCCTTCCACCGCGAGCTGGTGCCCGACCGCCTCTTCGTCTTCT-3' (as shown in SEQ NO: 4), wherein the base site with the underline is the 1165 site of the human ADRB1 gene, and the 1165 site is used to characterize that the GG type of the human ADRB1 gene can be mutated into a human Location of the CC type of the ADRB1 gene. The GG-type positive reference product also contains a buffer reagent, which is a Tris-HCl buffer solution with a pH of 7.6.
[0022] CC-type positive reference product is a reagent with a base sequence as the main component. The base seque...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com