Positive reference product using human ADRB1 gene 1165 locus GG type as template

A reference product and gene technology, applied in the field of molecular biology, to achieve the effect of solving quality inspection problems

Inactive Publication Date: 2019-06-14
踏石生物科技(苏州)有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims to provide a positive reference product with the GG type at the 1165 site of the human ADRB1 gene as a template, which is used to verify whether the test result of the GG type at the 1165 site of the human ADRB1 gene in the tested sample is accurate, and solves the problem of human Quality testing issues of ADRB1 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Positive reference product using human ADRB1 gene 1165 locus GG type as template
  • Positive reference product using human ADRB1 gene 1165 locus GG type as template
  • Positive reference product using human ADRB1 gene 1165 locus GG type as template

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0020] Example: A positive reference product based on the GG type at position 1165 of the human ADRB1 gene as a template

[0021] The GG type positive reference product is a reagent with a base sequence as the main component. The base sequence contains a human ADRB1 gene fragment, and the human ADRB1 gene fragment is 5'-GGCGGGCCCTCGCGCCTCGTGGCCCTGCGCGAGCAGAAGGCGCTCAGGACGCTGGGCATCATCATGGGCGTCTTCACGCT G TGCTGGCTGCCCTTCTTCCTGGCCAACGTGGTGAAGGCCTTCCACCGCGAGCTGGTGCCCGACCGCCTCTTCGTCTTCT-3' (as shown in SEQ NO: 4), wherein the base site with the underline is the 1165 site of the human ADRB1 gene, and the 1165 site is used to characterize that the GG type of the human ADRB1 gene can be mutated into a human Location of the CC type of the ADRB1 gene. The GG-type positive reference product also contains a buffer reagent, which is a Tris-HCl buffer solution with a pH of 7.6.

[0022] CC-type positive reference product is a reagent with a base sequence as the main component. The base seque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A positive reference product using the human ADRB1 gene 1165 locus GG type as a template is characterized in that the positive reference product is a reagent with a base sequence as a main component,and the base sequence comprises a human ADRB1 gene fragment shown in SEQ NO: 4, wherein the underlined base locus is the 1165 locus of the human ADRB1 gene, and the 1165 locus is utilized to characterize the position where the human ADRB1 gene GG type can be mutated to the human ADRB1 gene CC type. The product is used for verifying whether a detected sample contains the human ADRB1 gene 1165 locusGG type, and solves the problem of quality detection of the human ADRB1 gene.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a positive reference product using the GG type at the 1165 site of the human ADRB1 gene as a template. Auxiliary judgment for positive. Background technique [0002] Quality control substances refer to quality control substances used in in vitro diagnostics, which have target detection substances with known concentrations, and are necessary products to make people believe that the quality of a certain product or service can meet the specified quality requirements. The purpose of quality control is to verify the accuracy, effectiveness and specificity of the entire PCR reaction process, and to monitor the status of the detection system. After the instrument is officially put into use, it should be calibrated regularly to avoid experimental deviations caused by the instrument. Thirdly, after receiving each batch of new reagents, they should be pre-tested first to confir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6851C12N15/11
Inventor 孙茜
Owner 踏石生物科技(苏州)有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap