Multi-detection kit for breast cancer 21 gene
A detection kit and multiple detection technology, applied in the field of biomedicine, can solve the problems of heavy workload and large sample usage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment
[0098] Concrete embodiment, breast cancer 21 gene multiple detection kit, this detection kit comprises 21 pairs of primers, 36 specific Taqman probes, forms 9 groups of 4 heavy primer probe mixtures, 5 * RT Buffer, reverse transcriptase, RNase Inhibitor, dNTP, 10×PCR Buffer, MgCl 2 and DNA polymerase,
[0099] The 21 pairs of primers are as follows:
[0100] ACTB-F CAGCAGATGTGGATCAGCAAG
[0101] ACTB-R GCATTTGCGGTGGACGAT
[0102] GAPDH-F ATTCCACCCATGGCAAATTC
[0103] GAPDH-R GATGGGATTTCCATTGATGACA
[0104] RPLP0-F CCATTCTATCATCAACGGGTACAA
[0105] RPLP0-R TCAGCAAGTGGGAAGGTGTAATC
[0106] TFRC-F GCCAACTGCTTTCATTTGTG
[0107] TFRC-R ACTCAGGCCCATTTCCTTTA
[0108] GUSB-F CCCACTCAGTAGCCAAGTCA
[0109] GUSB-R CACGCAGGTGGTATCAGTCT
[0110] STK15-F CATCTTCCAGGAGGACCACT
[0111] STK15-R TCCGACCTTCAATCATTTCA
[0112] CTSL2-F TGTCTCACTGAGCGAGCAGAA
[0113] CTSL2-R ACCATTGCAGCCCTGATTG
[0114] ESR1-F CGTGGTGCCCCTCTATGAC
[0115] ESR1-R GGCTAGTGGGCGCATGTAG
[0116] GRB7-F C...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

