Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Target MYO9B related to malignant pleural effusion and application of target MYO9B

A malignant pleural effusion, MYO9B technology, applied in the field of animal genetic engineering, can solve problems such as abnormal cell proliferation, DNA mismatch, time and effort

Active Publication Date: 2019-09-27
BEIJING CHAOYANG HOSPITAL CAPITAL MEDICAL UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, this step requires a lot of time and effort, and is the rate-limiting step for conditional knockout of genes using the Cre / loxP system
(2) Cre enzyme, as an exogenous recombinase expressed in mammals, has certain potential toxicity, which can cause problems such as abnormal cell proliferation, DNA mismatch and chromosome deletion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Target MYO9B related to malignant pleural effusion and application of target MYO9B
  • Target MYO9B related to malignant pleural effusion and application of target MYO9B
  • Target MYO9B related to malignant pleural effusion and application of target MYO9B

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1. Construction method of MYO9B gene edited mouse model

[0054] 1. Preparation of sgRNA and Cas9 mRNA

[0055] 1. Design of target sequence

[0056] According to the MYO9B gene sequence (the Genbank number of the mRNA sequence of the MYO9B gene is NM_001142322.1, as shown in sequence 5 in the sequence listing. Wherein, the DNA sequence shown in the 171-6557th position of sequence 5 is the CDS sequence of the MYO9B protein of the coding mouse ), the designed target sequence is as follows:

[0057] 1#: TGGCTCGAAGCACTACGTGC (sequence 1);

[0058] 2#: AGGCTGGCAGCTCGGGCCGT (sequence 2).

[0059] 2. Preparation of sgRNA

[0060] (1) Using the eSpCas9(1.1) plasmid (addgene) as a template, PCR amplification was performed using invitro-sgMyo9b-1#.S and hU6.R primers to obtain a PCR product, which was in vitro transcription template 1;

[0061] The eSpCas9(1.1) plasmid (addgene) was used as a template, and the invitro-sgMyo9b-2#.S and hU6.R primers were used for PCR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a target MYO9B related to malignant pleural effusion and application of the target MYO9B. The invention further discloses any of the following 1)-5) application: 1) application of a substance inhibiting the activity of MYO9B protein in preparing a product for treating or assisting treatment of malignant pleural effusion; 2) application of the substance inhibiting the activity of MYO9B protein in preparing a product for lowering or reducing the amount of pleural effusion in patients with malignant pleural effusion; 3) application of a substance that inhibits or silences MYO9B gene expression in preparing the product for treating or assisting treatment of malignant pleural effusion; 4) application of the substance that inhibits or silences MYO9B gene expression in preparing the product for lowering or reducing the amount of pleural effusion in patients with malignant pleural effusion; 5) application of MYO9B protein and related signaling pathways thereof as targets in developing or designing the product of treating or assisting treatment of malignant pleural effusion.

Description

technical field [0001] The invention belongs to the technical field of animal genetic engineering, and specifically relates to the target MYO9B related to malignant pleural effusion and its application. Background technique [0002] Invasion of tumor cells into the pleura can lead to malignant pleural effusion (Malignant Pleural Effusion, MPE). In my country, the incidence of lung cancer ranks first among all cancers, and the mortality rate is the highest. However, the median survival time of lung cancer patients with MPE is significantly shorter than that of patients without MPE, and the quality of life is worse. Therefore, exploring the pathogenesis of MPE, discovering and diagnosing MPE earlier, and giving corresponding prevention and treatment measures are of great significance for improving the quality of life of patients. However, the pathogenesis of MPE is still not very clear. The interaction between the tumor and the host is the key to the formation of MPE, the tum...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/90C12N9/22A01K67/027A61K45/00A61K48/00A61P7/10
CPCC12N15/907C12N9/22A01K67/0275A61K45/00A61K48/005A61P7/10A01K2227/105A01K2267/03A01K2217/075
Inventor 施焕中伊凤双翟侃
Owner BEIJING CHAOYANG HOSPITAL CAPITAL MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com