Method for activating hSyn (human Synapsin I) promoter in tool cell and application of method for activating hSyn promoter in tool cell

A promoter and cell technology, applied in the field of genetic engineering, can solve problems such as difficult judgment of action efficiency, inability to perform relevant detection, long expression cycle, etc.

Active Publication Date: 2019-10-08
OBIO TECH SHANGHAI CORP LTD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the expression cycle of adeno-associated virus in vivo is long, and the efficiency of action is difficult to judge. Therefore, it is necessary to test the basic action efficiency in vitro before conducting in vivo experiments.
Commonly used tool cells ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for activating hSyn (human Synapsin I) promoter in tool cell and application of method for activating hSyn promoter in tool cell
  • Method for activating hSyn (human Synapsin I) promoter in tool cell and application of method for activating hSyn promoter in tool cell
  • Method for activating hSyn (human Synapsin I) promoter in tool cell and application of method for activating hSyn promoter in tool cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Construction of lentiviral expression vector containing sgRNA targeting hSyn promoter

[0048] This embodiment discloses a method for constructing a lentiviral expression vector containing sgRNA targeting the hSyn promoter, comprising the following steps:

[0049] (1) hSyn sgRNA oligonucleotide synthesis; design and synthesize three sgRNAs specifically targeting the hSyn promoter sequence, the sgRNA1 sequence is shown in SEQ ID NO:1, the sgRNA2 sequence is shown in SEQ ID NO:2, and the sgRNA3 sequence As shown in SEQ ID NO:3;

[0050] Wherein, the hSyn sgRNA sequence list is shown in Table 1 below.

[0051] Table 1 hSyn sgRNA sequence list

[0052] hSyn sgRNA1 GCGCTGCCTCAGTCTGCGGTGGG SEQ ID NO:1 hSyn sgRNA2 CCTCAGTCTGCGGTGGGCAGCGG SEQ ID NO:2 hSyn sgRNA3 GGGCGCGACCATCTGCGCTGCGG SEQ ID NO:3

[0053] (2) Dissolve the above primer pair with annealing buffer to a concentration of 20uM, incubate in a water bath at 95°C for 5mi...

Embodiment 2

[0058] The construction of embodiment 2 specific promoter hSyn expression vector

[0059] This embodiment discloses a method for constructing a specific promoter hSyn expression vector, comprising the following steps:

[0060] (1) Synthesize the hSyn-mNeonGreen nucleotide sequence with restriction sites and upstream and downstream homology arms;

[0061] (2) Plasmid pLenti-CMV-EGFP-3FLAG-PGK-Puro (structure such as image 3 indicated) were digested with Mlu I and Xba I. The 50μL enzyme digestion reaction system contains pLenti-CMV-EGFP-3FLAG-PGK-Puro 10ug, 10×Cutsmart (NEB) 5μL, Mlu I and Xba I 1μL each, make up to 50μL with water, digest at 37°C for 1h, and carry out 1% Agarose gel electrophoresis, cut off large fragments with a blade under ultraviolet light and recover and purify;

[0062] (3) Perform seamless cloning of the purified enzyme-cleaved product obtained in step (2) and the nucleotide sequence of hSyn-mNeonGreen in step (1). The 50 μL reaction system contains ...

Embodiment 3

[0064] Example 3 Construction of P65-HSF1 expression vector

[0065] This embodiment discloses a method for constructing a P65-HSF1 expression vector, comprising the following steps:

[0066] (1) Synthesize the MCP-P65-HSF1-2A-Hygro sequence with restriction sites and upstream and downstream homology arms;

[0067] (2) Plasmid pLenti-CMV-MCS-Wpre (structure such as Figure 5 shown) were digested with Sal I and Nhe I. 50 μL enzyme digestion reaction system contains pLenti-CMV-MCS-Wpre 10ug, 10×Cutsmart (NEB) 5 μL, 1 μL each of Sal I and Nhe I, make up to 50 μL with water, digest at 37°C for 1 hour, and perform 1% agarose gel Electrophoresis, cut off large fragments with a blade under ultraviolet light and recover and purify;

[0068] (3) Perform seamless cloning of the purified enzyme-cleaved product obtained in step (2) and the nucleotide sequence of MCP-P65-HSF1-2A-Hygro in step (1). The 50 μL reaction system contains (2) 102.2 ng of enzyme digestion products, (1) 14.3 ng...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of genetic engineering, and particularly provides a method for activating a hSyn (human Synapsin I) promoter in a tool cell and application of the method for activating the hSyn promoter in the tool cell. According to the method for activating the hSyn promoter in the tool cell, a CRISPR-Cas9 SAM (synergistic activation mediator) system is adopted. According to the method utilizing the CRIPSR-Cas9 SAM system, the activity of the neuronic specific promoter hSyn is activated in a common tool cell for verifying expression of the specific promoter in the tool cell, and an in vitro system is provided for detection of a novel neural tissue-specific promoter viral expression vector so that experimental data references are provided for use of the viral expressionvector in vivo. The method for activating the hSyn promoter in the tool cell and the application of the method for activating the hSyn promoter in the tool cell are of great significance in neurobiology research and also of great applicational value in the use of gene-targeted therapy for neurological diseases.

Description

technical field [0001] The invention relates to the field of genetic engineering, and specifically provides a method for activating hSyn promoter in tool cells and its application. Background technique [0002] The promoter is an important part of a gene, and its main function is to control the initiation time and degree of gene expression (transcription). Due to factors such as different folding degrees of chromosomes, different expression levels of transcription factors, and different promoter opening degrees and recruited transcription factors, the expression levels of most genes in different types of cells and in time are different, showing time specificity and Tissue-specific expression. The hSyn (human Synapsin I) promoter is the promoter of the human SYN1 gene. The expression of the SYN1 gene produces Synapsin I protein, which is a protein specifically expressed in neurons. Therefore, the hSyn promoter is generally selected as the neuron-specific promoter. [0003] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N15/867C12N15/90C12N15/113C12Q1/6897
CPCC12N15/113C12N15/85C12N15/86C12N15/907C12N2310/10C12N2310/20C12N2740/15043C12N2800/107C12N2810/10C12Q1/6897
Inventor 杨佳丽杨兴林马佩敏杨蕊菊潘讴东
Owner OBIO TECH SHANGHAI CORP LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap