Unlock instant, AI-driven research and patent intelligence for your innovation.

Nested PCR detection method for equine piroplasmosis

A detection method, the technology of Piroplasma, is applied in the direction of biochemical equipment and methods, and the determination/inspection of microorganisms. It can solve the problems of low diagnostic sensitivity, missed detection, and poor sensitivity of ordinary PCR, etc., and achieve good anti-interference and strong Specific and practical effect

Pending Publication Date: 2019-12-10
SHENYANG AGRI UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is a problem of low sensitivity in the diagnosis of common PCR. There will be a certain incubation period for equine piriplasmosis, and the sensitivity of common PCR is poor, which may easily cause missed detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nested PCR detection method for equine piroplasmosis
  • Nested PCR detection method for equine piroplasmosis
  • Nested PCR detection method for equine piroplasmosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: The following will further describe the present invention in combination with the embodiments, but it is not intended to limit the scope of the present invention, but is only illustrative.

[0032] Example 1

[0033] Establishment of a nested PCR detection method for equine pyriformosis.

[0034] (1) Primer design, conduct conservative analysis of the 18S ribosomal RNA coding genes of the two pathogens of equine pyriformiasis, select conservative regions to design two pairs of primers, namely the outer primer 18S Out-F, 18S Out-R and inner primer 18S In-F,

[0035] 18S In-R, refer to Table 1, its sequence is as follows:

[0036] 18S Out-F: CACATCTAAGGAAGGCAGCA

[0037] 18S Out-R: CAGGACATCTAAGGGCATCA

[0038] 18S In-F: TTGGAGGGCAAGTCTGGT

[0039] 18S In-R: TTTCGCAGTAGTTCGTCTTT

[0040] (2) Sampling and DNA extraction, blood was collected from the neck vein of the horse to be tested using a vacuum anticoagulation tube, centrifuged for 30 minutes, 200 μL of blood at the ...

Embodiment 2

[0046] Detection of characteristics of nested PCR primers.

[0047] (1) Specificity test: Dilute the standard positive plasmid into different concentrations (1×10 -1 To 1×10 -9 ng / μL) template is subjected to nested PCR amplification to determine the lowest detection efficiency that can be detected and calculate the copy number.

[0048] Determine the template concentration corresponding to the final detection concentration according to the brightness of the corresponding band, and calculate the minimum detection efficiency of the nested PCR detection method for equine pyriformiasis established in this experiment by using the copy number calculation formula.

[0049] Use the standard positive samples of pyriformis equine, DNA samples of Theileria sinensis, and use the negative pyriformis equine samples as the control group to perform nested PCR amplification test to evaluate the specificity of the test. See the test results figure 1 .

[0050] (2) Sensitivity test: perform 10-fold dil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a nested PCR detection method for equine piroplasmosis. The nested PCR detection method comprises the following steps: (1) conducting conservative analysis on 18S ribosomal RNA coding genes of two pathogens of the equine piroplasmosis and designing two pairs of primers by selecting a conservative region; (2) extracting DNA to be detected; (3) taking the DNA extracted in the step (2) as a template and preparing a PCR reaction system by using the outer primers designed in the step (1); and performing electrophoresis detection on a PCR product and performing secondary amplification if no target band exists in a 1,036 bp region; and (4) taking the first round nested PCR product in the step (3) as a template and preparing a PCR reaction system by using the outerprimers designed in the step (1); and performing electrophoresis detection on the PCR product, judging whether a target band appears in a 370 bp region, and if yes, judging the result positive. The method is relatively strong in specificity, relatively good in anti-interference performance, high in reliability and strong in practicability.

Description

Technical field [0001] The invention relates to a method for detecting horse pyriformiasis, in particular to a nested PCR detection method for horse pyriformiasis. . Background technique [0002] Equine Piroplasmosis (Equine Piroplasmosis, EP) is a blood protozoal disease caused by a piriformis parasitic in the red blood cells of equine animals, causing a series of clinical symptoms and even death in equine animals. The main clinical feature of this disease is acute hemolytic anemia. Other features include high fever, dyspnea, anemia and jaundice. [0003] The name of horse pyriformiasis is derived from the "pear-shaped" morphological appearance of the pyriformes when replicating in red blood cells. Studies have found that the Pyriformis pathogens that infect equine animals and cause equine piriformosis include Apicomplexa (Apicomplexa), Sporozoasida (Sporozoasida), Piroplasmasina (Babesiidae) and Babesiidae. Babesia caballi (Babesia caballi) and Theileria equi (Theileria equi) ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6893C12Q1/6848
CPCC12Q1/6893C12Q1/6848C12Q2549/119C12Q2531/113
Inventor 陈启军刘铮姜宁
Owner SHENYANG AGRI UNIV