Nested PCR detection method for equine piroplasmosis
A detection method, the technology of Piroplasma, is applied in the direction of biochemical equipment and methods, and the determination/inspection of microorganisms. It can solve the problems of low diagnostic sensitivity, missed detection, and poor sensitivity of ordinary PCR, etc., and achieve good anti-interference and strong Specific and practical effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1: The following will further describe the present invention in combination with the embodiments, but it is not intended to limit the scope of the present invention, but is only illustrative.
[0032] Example 1
[0033] Establishment of a nested PCR detection method for equine pyriformosis.
[0034] (1) Primer design, conduct conservative analysis of the 18S ribosomal RNA coding genes of the two pathogens of equine pyriformiasis, select conservative regions to design two pairs of primers, namely the outer primer 18S Out-F, 18S Out-R and inner primer 18S In-F,
[0035] 18S In-R, refer to Table 1, its sequence is as follows:
[0036] 18S Out-F: CACATCTAAGGAAGGCAGCA
[0037] 18S Out-R: CAGGACATCTAAGGGCATCA
[0038] 18S In-F: TTGGAGGGCAAGTCTGGT
[0039] 18S In-R: TTTCGCAGTAGTTCGTCTTT
[0040] (2) Sampling and DNA extraction, blood was collected from the neck vein of the horse to be tested using a vacuum anticoagulation tube, centrifuged for 30 minutes, 200 μL of blood at the ...
Embodiment 2
[0046] Detection of characteristics of nested PCR primers.
[0047] (1) Specificity test: Dilute the standard positive plasmid into different concentrations (1×10 -1 To 1×10 -9 ng / μL) template is subjected to nested PCR amplification to determine the lowest detection efficiency that can be detected and calculate the copy number.
[0048] Determine the template concentration corresponding to the final detection concentration according to the brightness of the corresponding band, and calculate the minimum detection efficiency of the nested PCR detection method for equine pyriformiasis established in this experiment by using the copy number calculation formula.
[0049] Use the standard positive samples of pyriformis equine, DNA samples of Theileria sinensis, and use the negative pyriformis equine samples as the control group to perform nested PCR amplification test to evaluate the specificity of the test. See the test results figure 1 .
[0050] (2) Sensitivity test: perform 10-fold dil...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



