Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nano-antibody to green fluorescent proteins (GFPs), application of nano-antibody, and GFP immunoaffinity adsorbing material

A technology of green fluorescent protein and nano-antibody, which is applied in the application, analysis of materials, material inspection products, etc., can solve the problems of poor antibody stability, high production cost, and complexity, and achieve simple production process, high specificity, and small molecular weight. Effect

Active Publication Date: 2020-01-07
北京兰博利德商贸有限公司 +1
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, most of the monoclonal or polyclonal antibodies against GFP are used for detection in the market, but the development and production process of monoclonal antibodies is extremely cumbersome and complicated, and the antibody stability is poor, the production cost is high, and the source of polyclonal antibodies is limited
Since traditional antibodies contain Fc segments, they are prone to non-specific binding or contamination

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nano-antibody to green fluorescent proteins (GFPs), application of nano-antibody, and GFP immunoaffinity adsorbing material
  • Nano-antibody to green fluorescent proteins (GFPs), application of nano-antibody, and GFP immunoaffinity adsorbing material
  • Nano-antibody to green fluorescent proteins (GFPs), application of nano-antibody, and GFP immunoaffinity adsorbing material

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1: Construction of a Nanobody library for GFP:

[0062] (1) The concentration of GFP is 500 micrograms per milliliter. For each immunization, mix 1 mg of GFP with Freund's adjuvant in an equal volume to immunize a Xinjiang Bactrian camel once a week for a total of 4 times. Freund's adjuvant, and Freund's incomplete adjuvant was used for the remaining several times to stimulate B cells to express antigen-specific nanobodies during the immunization process.

[0063] (2) After the 4 times of immunization, extract 100 ml of camel peripheral blood lymphocytes and extract total RNA, referring to the RNA extraction kit provided by QIAGEN.

[0064] (3) According to the instructions of Super-Script III FIRST STRANDSUPERMIX kit, the extracted RNA was reverse-transcribed into cDNA and the VHH chain was amplified by nested PCR. The first round of PCR:

[0065] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC

[0066] Downstream primer: GGTACGTGCTGTTGAACTGTTCC

[0067] Amplify t...

Embodiment 2

[0075] Embodiment 2: Nanobody screening process against GFP:

[0076] (1) Dissolve in 100mM pH 8.2NaHCO 3 200 micrograms of GFP in the medium were coupled to a microtiter plate, placed overnight at 4°C, and a negative control was set up at the same time.

[0077] (2) On the second day, 100 microliters of 0.1% casein were added to the two wells respectively, and blocked for 2 hours at room temperature.

[0078] (3) After 2 hours, add 100 μl phage (8*10 11 tfu immunized camel nanobody phage display gene library) and acted for 1 hour at room temperature.

[0079] (4) Wash 5 times with PBST (PBS containing 0.05% Tween 20) to wash away unbound phages.

[0080] (5) Use triethylamine (100mM) to dissociate the phage that specifically binds to GFP, and infect Escherichia coli TG1 that is in logarithmic growth, produce and purify the phage for the next round of screening, the same screening process Repeat for 3-4 rounds. In the process of continuous screening, positive clones will ...

Embodiment 3

[0081] Embodiment 3: use the enzyme-linked immunosorbent method (ELISA) of phage to screen specificity single positive clone:

[0082] (1) From the cell culture dish containing phage after the above 3-4 rounds of selection, pick 96 single colonies and inoculate them in TB medium containing 100 micrograms per milliliter of ampicillin (1 liter of TB medium contains 2.3 grams of phosphoric acid Potassium dihydrogen, 12.52 grams of dipotassium hydrogen phosphate, 12 grams of peptone, 24 grams of yeast extract, 4 milliliters of glycerol), after growing to the logarithmic phase, add IPTG with a final concentration of 1 millimolar, and cultivate overnight at 28 ° C.

[0083] (2) Obtain the crudely extracted antibody by infiltration method, transfer the antibody to an antigen-coated ELISA plate, and place it at room temperature for 1 hour.

[0084] (3) Unbound antibodies were washed away with PBST, a mouse anti-HAtag antibody (anti-mouse anti-HA antibody, purchased from Beijing Kangwe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nano-antibody to green fluorescent proteins (GFPs). The antibody has the amino acid sequence shown as SEQ ID NO.1. The nano-antibody is a single-domain antibody heavy-chainantibody (namely the nano-antibody) capable of specifically bound with the GFPs, can be used for detection and purification of the GFPs and GFP fusion proteins, for example used for preparing reagents, tools and the like for detection and purification of the GFPs.

Description

technical field [0001] The invention belongs to the field of single-domain heavy chain antibody technology (also known as nanobody technology) and genetic engineering antibody technology, in particular to a nanobody for green fluorescent protein (GFP), its application and GFP immunoaffinity adsorption material. Background technique [0002] GFP is a protein composed of about 238 amino acids, which can be excited by blue light to ultraviolet light and emit green fluorescence. GFP is widely used in immunological detection, cell imaging, affinity purification and protein engineering and other fields. [0003] At present, most of the monoclonal or polyclonal antibodies against GFP are used for detection on the market, but the development and production process of monoclonal antibodies is extremely cumbersome and complicated, and the antibody stability is poor, the production cost is high, and the source of polyclonal antibodies is limited. Since traditional antibodies contain F...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/18C12N15/13G01N33/533G01N33/68
CPCC07K16/18G01N33/533G01N33/68
Inventor 董春明
Owner 北京兰博利德商贸有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com