Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of probe and method for identifying the genetic sex of the chequerster

A technique for the sexing of the gridworm, applied in the field of identification of the genetic sex of the gridworm, to achieve the effect of promoting improvement

Active Publication Date: 2022-05-31
HUAQIAO UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In addition, there have been no reports on the female-specific molecular probes and their applications of P.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of probe and method for identifying the genetic sex of the chequerster
  • A kind of probe and method for identifying the genetic sex of the chequerster
  • A kind of probe and method for identifying the genetic sex of the chequerster

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] The present invention takes SEQ ID NO: 1 as a starting point, and establishes a checkered starworm sex-specific molecular probe.

[0035] R1: AGGAGAGATGGTTGTGGGACT (SEQ ID NO: 3).

[0045]

[0046] The PCR reaction program is: 95°C pre-denaturation for 30 seconds, 95°C for 30 seconds, 58°C for 30 seconds, 72°C for 30 seconds, 39 cycles, 72°C

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a probe and a method for identifying the genetic sex of the phalaenopsis. The invention uses a high-throughput sequencing method to identify a female-specific gene fragment through bioinformatics analysis. The sequence is SEQ ID NO: 1 According to the gene fragment, the specific primers F1 and R1 for identifying the genetic sex of the gridworm are designed, and the primers only have amplified products in female individuals. The present invention is not limited by factors such as the developmental period and individual size of the phalanx, extracting a certain amount of body cavity fluid can quickly, accurately and effectively distinguish the genetic sex of the phalanx; and without killing the worm body, the genetic sex The identified worms can still be used for production and breeding practice. The invention can effectively promote the improvement of the artificial propagation technology of the scatterworm, and has important theoretical significance and application value for the cultivation practice of the splatter worm.

Description

A kind of probe and method for identifying the genetic sex of the chequered star worm technical field The present invention relates to marine starworm genetic sex identification and sex control in aquatic biotechnology and aquaculture field. The invention relates to a manufacturing technology, and specifically relates to a method and a probe for identifying the genetic sex of the Platyhelminthes. Background technique The square star worm (Sipunculus nudus) is commonly known as " sand worm ", is widely distributed in the southeast coast of my country, is a kind of name Expensive seafood treasures. This species is delicious, nutritious, and has important edible and medicinal value. used in production The square star worms mainly come from natural fishing. However, due to over-exploitation and environmental pollution, the star worm resources have declined sharply, so it is urgent to It is necessary to further explore the reproductive mechanism of the scutellaria to im...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6879C12Q1/686C12N15/11
CPCC12Q1/6879C12Q1/686C12Q2600/124C12Q2565/125Y02A50/30
Inventor 李文华吴雅琴陈琪薇
Owner HUAQIAO UNIVERSITY