Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sequence of MicroRNA used for early diagnosis of type 2 diabetes and application of sequence of microRNA used for early diagnosis of type 2 diabetes

A type 2 diabetes, early diagnosis technology, applied in the field of medicine, can solve problems such as the mechanism is not very clear, and achieve the effect of promoting lipid synthesis, inhibiting the ability of cells to metabolize glucose, and reducing insulin sensitivity

Pending Publication Date: 2020-04-03
SHIHEZI UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Recent literature has shown that obesity can cause T2DM, but the specific mechanism is not yet clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequence of MicroRNA used for early diagnosis of type 2 diabetes and application of sequence of microRNA used for early diagnosis of type 2 diabetes
  • Sequence of MicroRNA used for early diagnosis of type 2 diabetes and application of sequence of microRNA used for early diagnosis of type 2 diabetes
  • Sequence of MicroRNA used for early diagnosis of type 2 diabetes and application of sequence of microRNA used for early diagnosis of type 2 diabetes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] 1. Collection of human samples:

[0017] (1) Sample grouping and sources: From December 2016 to December 2018, serum samples from 24 normal Uyghur individuals, 48 ​​serum samples from obese individuals, and diabetes 24 individual serum samples; 24 normal Kazak individual serum samples, 48 ​​obese individual serum samples, and 10 diabetic individual serum samples; 21 Han normal individual serum samples, 22 obese individuals, and 20 diabetic individuals.

[0018] (2) Inclusion and exclusion criteria of samples: normal group: 40 years old < age < 50 years old; body mass index (BMI) <24kg / m2; fasting blood glucose <6.1mmol / l; triglyceride (TG) <1.7mmol / l ;Total cholesterol (TC)<5.17mmol / l; Gender: 1:1 matching; Obesity group: 40 years old<age<50 years old; BMI≥28kg / m2; Fasting blood glucose<6.1mmol / l; Gender: 1:1 matching ;T2DM group: 38 years old <age <50 years old; fasting blood glucose ≥7.0mmol / l; sex: 1:1 matching.

[0019] (3) Collection and storage of blood samples:...

Embodiment 2

[0066] Example 2 microRNA-450a-5p is closely related to obesity and type 2 diabetes

[0067] 1. microRNA-450a-5p is significantly overexpressed in obese and type 2 diabetic individuals

[0068] In 24 normal, 24 obese, and 24 T2DM Han individuals; 24 normal, 48 obese, and 11 T2DM Kazakh individuals; 24 normal, 48 obese, and 24 T2DM Uighur individuals serum microRNA-450a The copy number of -5p(UUUUGCGAUGUGUUCCUAAUAU) was verified, and the results showed that compared with the normal group, the copy number of this sequence in the obesity group and the T2DM group was significantly increased (P<0.05), suggesting that microRNA-450a-5p(UUUUGCGAUGUGUUCCUAAUAU) may It is closely related to the occurrence and development of type 2 diabetes.

[0069] 2. The expression of microRNA-450a-5p is significantly positively correlated with glucose and lipid metabolism

[0070] SPSS 25.0 analyzed the correlation between microRNA-450a-5p and related indicators of glucose and lipid metabolism. Spe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sequence of microRNA used for early diagnosis of type 2 diabetes and application of the sequence of the microRNA used for early diagnosis of type 2 diabetes, and belongs to the technical field of medicines. The sequence is microRNA-X, the sequence of the microRNA is shown in SEQ: ID: NO: 1 as shown in the description, and sequences of designed primers are shown in SEQ: ID: NO: 2 as shown in the description and SEQ: ID: NO: 3 as shown in the description. According to the sequence of the microRNA used for early diagnosis of type 2 diabetes and application of the sequence of the microRNA used for early diagnosis of type 2 diabetes, on the basis of in-vitro culture of a human liver cancer cell line HepG2, a in-vitro mimic sequence of microRNA-450a-5p is applied, and after the microRNA-450a-5p is regulated up, effects on the glucose metabolism capability and the lipid metabolism capability of HepG2 cells are observed.

Description

technical field [0001] The invention belongs to the technical field of medicine, and relates to a microRNA sequence for early diagnosis of type 2 diabetes and its application. Background technique [0002] The incidence of type 2 diabetes (T2DM) has been increasing year by year in the world in recent years, becoming the fifth leading cause of death in the world. According to the forecast of the World Health Organization (WHO), by 2025 there will be 300 million people with diabetes in the world, of which 230 million people are in developing countries, and the number of new people with diabetes in China will account for the first place in the world. According to the survey results of Ning G et al., the current prevalence of T2DM in Chinese adults is 11.6%, and 50.1% of the adult population is in a pre-diabetic state. Epidemiological data show that 80% of T2DM patients are obese, and obesity has become an important risk factor for IR and T2DM. Recent studies have shown that a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/113
CPCC12Q1/6883C12Q2600/178C12Q2600/158
Inventor 张君朱娇娇王翠喆谢建新
Owner SHIHEZI UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com