Sequence of MicroRNA used for early diagnosis of type 2 diabetes and application of sequence of microRNA used for early diagnosis of type 2 diabetes
A type 2 diabetes, early diagnosis technology, applied in the field of medicine, can solve problems such as the mechanism is not very clear, and achieve the effect of promoting lipid synthesis, inhibiting the ability of cells to metabolize glucose, and reducing insulin sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] 1. Collection of human samples:
[0017] (1) Sample grouping and sources: From December 2016 to December 2018, serum samples from 24 normal Uyghur individuals, 48 serum samples from obese individuals, and diabetes 24 individual serum samples; 24 normal Kazak individual serum samples, 48 obese individual serum samples, and 10 diabetic individual serum samples; 21 Han normal individual serum samples, 22 obese individuals, and 20 diabetic individuals.
[0018] (2) Inclusion and exclusion criteria of samples: normal group: 40 years old < age < 50 years old; body mass index (BMI) <24kg / m2; fasting blood glucose <6.1mmol / l; triglyceride (TG) <1.7mmol / l ;Total cholesterol (TC)<5.17mmol / l; Gender: 1:1 matching; Obesity group: 40 years old<age<50 years old; BMI≥28kg / m2; Fasting blood glucose<6.1mmol / l; Gender: 1:1 matching ;T2DM group: 38 years old <age <50 years old; fasting blood glucose ≥7.0mmol / l; sex: 1:1 matching.
[0019] (3) Collection and storage of blood samples:...
Embodiment 2
[0066] Example 2 microRNA-450a-5p is closely related to obesity and type 2 diabetes
[0067] 1. microRNA-450a-5p is significantly overexpressed in obese and type 2 diabetic individuals
[0068] In 24 normal, 24 obese, and 24 T2DM Han individuals; 24 normal, 48 obese, and 11 T2DM Kazakh individuals; 24 normal, 48 obese, and 24 T2DM Uighur individuals serum microRNA-450a The copy number of -5p(UUUUGCGAUGUGUUCCUAAUAU) was verified, and the results showed that compared with the normal group, the copy number of this sequence in the obesity group and the T2DM group was significantly increased (P<0.05), suggesting that microRNA-450a-5p(UUUUGCGAUGUGUUCCUAAUAU) may It is closely related to the occurrence and development of type 2 diabetes.
[0069] 2. The expression of microRNA-450a-5p is significantly positively correlated with glucose and lipid metabolism
[0070] SPSS 25.0 analyzed the correlation between microRNA-450a-5p and related indicators of glucose and lipid metabolism. Spe...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com