A method for overcoming transgene silencing effects by activating RNA-regulated promoters

A promoter and transgene technology, applied in the direction of DNA / RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of low expression efficiency of recombinant antibodies and protein expression vectors, achieve effective transgene silencing effect and reduce costs , the effect of overcoming the effect of transgene silencing

Active Publication Date: 2020-12-22
KUNMING UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The technical problem to be solved by the present invention is to provide a method for overcoming the silencing effect of transgenes by activating RNA-regulated promoters in view of the low expression efficiency of recombinant antibodies and protein expression vectors that currently exist, so as to construct sustained, stable and efficient expression Carriers to meet the needs of industrial production and promotion, and reduce the cost of recombinant antibodies and protein drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for overcoming transgene silencing effects by activating RNA-regulated promoters
  • A method for overcoming transgene silencing effects by activating RNA-regulated promoters
  • A method for overcoming transgene silencing effects by activating RNA-regulated promoters

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0037] Example: The method of the present invention uses a promoter that does not contain an enhancer and contains a CpG island at the transcription start site as the target promoter, and the human SOX2 gene promoter meets the requirements of the target promoter. This example Taking the human SOX2 gene promoter as an example to illustrate the method for constructing the final vector of the present invention:

[0038] Ⅰ. Replace the CMV promoter in the exogenous gene expression frame on the PEGFP-C1 vector with the human SOX2 gene promoter to construct an intermediate vector Ⅰ

[0039] (1) Cloning using human SOX2 gene promoter

[0040] Through human SOX2 gene promoter amplification, the amplification primers are:

[0041] SOX2# forward primer: CCGTGATTAAT(Ase I)AGACAAGGAAGGTTTTGAGGAC

[0042] SOX2# reverse primer: ATATGACCGGT(Age I)ATCCGGGCTGTTTTTCTGGTT

[0043] Use high-fidelity TAQ enzyme, 50μL system for PCR amplification, the amplification conditions are: 95°C for 5 min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for activating RNA (ribonucleic acid) to regulate and control a promoter to overcome a transgene silencing effect. The method comprises the following steps: selectinga promoter which contains no enhanser and has a CpG island at a transcriptional start locus as a target promoter, implementing an in-vitro recombination technique, inserting a UCOE (ubiquitous chromatin opening element) truncation sequence in front of the target promoter, inserting a shRNA (short hairpin ribonucleic acid) gene expression frame of an expression activation RNA gene expressing targeting to the target promoter at the downstream of the target promoter, and establishing a final vector which is capable of continuously, stably and efficiently expressing an EGFP (enhanced green fluorescent protein) gene in a target promoter expression frame, so as to overcome the transgene silencing effect. The method disclosed by the invention can be applied to the field of industrial production of antibodies and protein medicines or gene treatment, the production efficiency can be improved, the production cost can be lowered, and good social benefits and economic benefits can be made.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to an expression vector used in the production of recombinant antibodies or protein drugs and a construction method thereof, in particular to a method for overcoming the transgene silencing effect by activating RNA to regulate a promoter. Background technique [0002] Recombinant antibodies and protein drugs are specific drugs used clinically in recent years, but their wide application is limited due to their high price. In the cost structure of recombinant antibodies and protein drugs, low production efficiency is still an important factor. In the complex production process of recombinant antibodies and protein drugs, whether the vector can be efficiently expressed is one of the key technical factors affecting production efficiency. Although there are many solutions for high-efficiency expression vectors, the concentrated problem is still to overcome the position effect and silencing ef...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/113
CPCC12N15/113C12N15/85C12N2830/002
Inventor 王斌刘凌云殷旭东王德斌翟书华范志伟
Owner KUNMING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap