EpCAM gene humanized mouse tumor cell model as well as construction method and use thereof

A construction method and tumor cell technology, which can be used in the construction of muEpCAM gene humanized mouse tumor cell model, the application field of biomedicine, and can solve problems such as limitations

Pending Publication Date: 2020-06-09
NANJING BIOHENG BIOTECH CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, complex biological processes often require in vivo analysis, and the study of human in vivo biology is severely restric

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • EpCAM gene humanized mouse tumor cell model as well as construction method and use thereof
  • EpCAM gene humanized mouse tumor cell model as well as construction method and use thereof
  • EpCAM gene humanized mouse tumor cell model as well as construction method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0052] 1.1 muEpCAM sgRNA design

[0053] 1.1.1 sgRNA oligonucleotide chain synthesis

[0054] Use the CRISPR online design tool (http: / / crispr.mit.edu / ) to design two 20bp sgRNAs on exon 3 of EpCAM according to the scoring system. The core sequence on the exon was found according to these two criteria: EpCAMsgRNA-1 and EpCAM sgRNA-2. CACCG was added to the 5′ end of the coding strand template, and AAAC…………….C was added to the 3′ end of the non-coding strand template to complement the cohesive ends formed after BsmbI digestion, and two pairs of CRISPR oligonucleotide chains were designed.

[0055] 1.1.2 Exon 3 sequence of muHer2:

[0056] As shown below, where the underline is the target position:

[0057] TGGCGTCTAAATGCTTGGCGATGAAAGCAGAAATGACTCACAGCAAGTCTGGGAGGAGGATAAAGCCCGAAGGGGCGATCCAGAACAACGATGGGCTGTACGACC CCG ACTGCGACGAGCAGGGGCTC TTCAAAGCCAAAGCAGTGCAACGGCACCGCCACGTGCTGGTGTGTCAACACCGCCGGAGTCCGAAGAACCGACAAGGACACGGAGA TCACGTGCTCC GAGCGCGTG AGG ACCTA (SEQ ID NO. 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the fields of genetic engineering and genetic modification of mouse cells, and particularly relates to an EpCAM gene humanized mouse tumor cell model as well as a constructionmethod and application thereof. A mouse EpCAM gene is knocked out by virtue of a CRISPR technique, and meanwhile, the humanized EpCAM gene is inserted into a mouse colon cancer cell CT26 through lentivirus infection. The EpCAM gene humanized mouse tumor cell model can be used for evaluating antibody tumor pesticide effect and has important guiding significance to clinic effects of developed drugs. Meanwhile, the EpCAM gene humanized mouse tumor cell model is an ideal mouse tumor cell model for evaluating the safety of anti-EpCAM antibody drugs and can be used for carrying out preclinical in-vivo evaluation on toxicological immunocell therapies of EpCAM antibody drugs and EpCAM-CAR T, EpCAM-CAR NK, so that a market blank is filled up.

Description

technical field [0001] The invention belongs to the technical field of mouse cell genetic engineering and genetic modification, and relates to a method for constructing a muEpCAM gene humanized mouse cell tumor cell model based on CRISPR / Cas9 technology and its application in biomedicine. Background technique [0002] In recent years, monoclonal antibodies have attracted widespread attention as adjuvant chemotherapy for malignant tumors, one of which is anti-tumor-associated antigen EpCAM (EGP-40, Trop-1, 17-1A, KSA, KS1 / 4, AUA-1, GA733 -2) Monoclonal antibodies. EpCAM is a glycoprotein expressed on the surface of some normal human epithelial cells and most malignant epithelial cells. It is generally believed that it plays an important role in the biological characteristics of tumors, especially in colorectal cancer. [0003] In 1979, in the study of tumor cell surface antigens, it was found that EpCAM is a pancreatic cancer antigen, and the gene encoding the extracellul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N5/10C12N15/113C12N15/867C12N15/90C12Q1/02
CPCC07K14/4748C12N15/113C12N15/86C12N15/907G01N33/5011C12N2740/15043C12N2310/20G01N2500/10
Inventor 赵恩峰贺小宏王延宾任江涛韩露
Owner NANJING BIOHENG BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products