RHD-T268A mutant and detection thereof
A technology of RHD-T268A and mutants, applied in the field of molecular biology, can solve problems such as inability to obtain correct results and difficult judgment of results, and achieve the effect of extensive scientific research and application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0011] Attached below Figures 1 to 2 The present invention will be further described.
[0012] A RhD blood group antigen RHD-T268A mutant refers to the mutation occurring at the 25303322 position of chromosome 1, the 257th base A is mutated to G, and the wild-type RHD gene is shown in SEQ ID NO: 1 sequence, The mutant RHD gene is shown in the sequence of SEQ ID NO: 2; the number of this gene in the NCB1 reference database GRCh38.p13 is NC_000001.11 (25272393-25330445). The wild-type amino acid sequence of the coding sequence of the RHD gene is shown in SEQ ID NO: 5, wherein the amino acid change is from threonine T to alanine A at position 268 of the sequence of SEQ ID NO: 6.
[0013] SEQ ID NO:1
[0014] GACTTCCCAGCTCATTCCCTAAATGCTGCACAATCAGGGTAACTGTGTCCTGAGCCTAAGAGGCAGTAGTGAGCTGGCCCATCATGTCCACTGATGAAGGACACGTAGCCCCAACACAGGGGAGAAGTGGTTTCAGGATCAGCAAAGCAGGGAGGATGTTACAGGGTTGCCTTGTTCCCAGCGTGCCGGTCACTTGCAGCAAGGATGGTGTTCTCACTTCACTTCCT A CTTATGTGCACACGTGCGGTGTTGGCAGGAGGCGTGGCTGTG...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com