A kind of method for improving biofilm formation of Citrobacter welchii

A technology of Citrobacter bacillus and biofilm, applied in the field of genetic engineering, can solve the problems such as limited ability of Citrobacter welchii biofilm formation and poor environmental adaptability, etc.

Active Publication Date: 2021-05-28
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a kind of method that improves the biofilm formation of Citrobacter wilsonii for the limited biofilm formation ability of Citrobacter wilsonii in the prior art, which can improve the quality of Citrobacter wilsonii lemon. The formation of acid bacilli biofilm can improve the resistance to fungicides, thereby improving its application potential in environmental governance and other aspects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method for improving biofilm formation of Citrobacter welchii
  • A kind of method for improving biofilm formation of Citrobacter welchii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] The following examples are to further illustrate the present invention, rather than limit the present invention.

[0020] The Citrobacter welkii used in the following examples is Citrobacter welmannii BF-6.

[0021] The primers used in the following examples are as follows:

[0022] ACGCCTGTCTCAAGCGGTTTTC(ompA-identify-F);

[0023] AAGAAGCATCGTGAGGGGGAAT(ompA-identify-R).

[0024] 1. Construction of ompA knockout vector

[0025] First, the upstream and downstream sequences (upstream 1005bp (corresponding to the 9th to 1013th bases of SEQ ID NO.2) of the ompA gene (its nucleotide sequence is shown in SEQ ID NO.1) and downstream 876bp (corresponding to the 1014th to 1889th bases of SEQ ID NO.2)) integrated together (without ompA gene itself sequence), then add BglII restriction site (GAAGATCT) at the front of the integrated sequence, followed by Add the SpeI restriction site (ACTAGTCC) and the protective base to the end, and entrust Shanghai Meiji Biomedical Technolog...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the biofilm formation of Citrobacter wilsonii. The invention provides a method for improving the biofilm formation ability of Citrobacter welmannii by knocking out the outer membrane protein ompA gene of the strain; constructing a knockout vector by using the plasmid pYG4, and using the principle of gene homologous recombination to convert the ompA gene Knockout to obtain ΔompA. The traits of ΔompA were analyzed by methods such as crystal violet staining, and the results showed that compared with wild Citrobacter wilsonii, the biofilm formation ability of ΔompA was increased by more than 4 times, and its resistance to isothiazolinone fungicides also increased accordingly. The ompA knockout strain constructed by the present invention can effectively increase the biofilm formation and drug resistance level of Citrobacter welmannii, thereby broadening the application scenarios and possibilities of Citrobacter welmannii for heavy metal ion adsorption and construction of cell protein synthesis factories. scope.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a method for improving the biofilm formation of Citrobacter wilsonii. Background technique [0002] Citrobacter welmanii, a Gram-negative bacterium, is able to utilize L-arabinose, maltose, rhamnose, trehalose, D-xylose, D-mannose, and D-sorbose through peri-flagellar movement Sugar alcohols, etc. are single carbon sources, and the reaction is positive for malonate and m-hydroxybenzoate, which are usually found in water, soil, animal and human intestines. Based on the above physiological characteristics of Citrobacter weimanii, it has been applied in the field of environmental governance, such as Citrobacter weimani itself, especially the biofilm formed by it, has a good ability to accumulate heavy metals and is used for heavy metal pollution in the environment However, due to its limited ability to form a biofilm, even if a biofilm is formed, its environmental ada...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/74C12N1/21C12Q1/18C12R1/01
CPCC07K14/24C12N15/74C12Q1/18
Inventor周刚王颖思彭红施庆珊谢小保李素娟孙廷丽沈鹏飞
OwnerGUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY