A kind of method for improving biofilm formation of Citrobacter welchii
A technology of Citrobacter bacillus and biofilm, applied in the field of genetic engineering, can solve the problems such as limited ability of Citrobacter welchii biofilm formation and poor environmental adaptability, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0019] The following examples are to further illustrate the present invention, rather than limit the present invention.
[0020] The Citrobacter welkii used in the following examples is Citrobacter welmannii BF-6.
[0021] The primers used in the following examples are as follows:
[0022] ACGCCTGTCTCAAGCGGTTTTC(ompA-identify-F);
[0023] AAGAAGCATCGTGAGGGGGAAT(ompA-identify-R).
[0024] 1. Construction of ompA knockout vector
[0025] First, the upstream and downstream sequences (upstream 1005bp (corresponding to the 9th to 1013th bases of SEQ ID NO.2) of the ompA gene (its nucleotide sequence is shown in SEQ ID NO.1) and downstream 876bp (corresponding to the 1014th to 1889th bases of SEQ ID NO.2)) integrated together (without ompA gene itself sequence), then add BglII restriction site (GAAGATCT) at the front of the integrated sequence, followed by Add the SpeI restriction site (ACTAGTCC) and the protective base to the end, and entrust Shanghai Meiji Biomedical Technolog...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com