A kind of monoclonal antibody and application thereof for neutralizing Epstein-Barr virus

A technology of Epstein-Barr virus and antibodies, applied in the fields of antibodies, applications, antiviral agents, etc., can solve the problems of human monoclonal antibodies on the market, and achieve the effect of reducing side effects

Active Publication Date: 2021-12-21
TSINGHUA UNIV +1
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still no human monoclonal antibody against EBV envelope glycoprotein on the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of monoclonal antibody and application thereof for neutralizing Epstein-Barr virus
  • A kind of monoclonal antibody and application thereof for neutralizing Epstein-Barr virus
  • A kind of monoclonal antibody and application thereof for neutralizing Epstein-Barr virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Preparation of EBV gH / gL recombinant protein

[0041] The gH / gL protein plays an important role in the process of EBV invasion of epithelial cells and B cells. Therefore, the inventor's research team selected gH / gL as the bait protein to screen specific memory B cells in order to obtain neutralizing antibodies that can block EBV infection.

[0042] Then, the genome of the EBV-M81 strain was selected as a template to amplify the sequences of gH and gL respectively, and link them together through a linker to improve the efficiency of protein purification.

[0043] The original sequence of gH before modification:

[0044] ATGCAGTTGCTCTGTGTTTTTTGCCTGGTGTTGCTATGGGAGGTGGGGGCTGCCAGCCTTAGCGA GGTTAAGCTGCACCTGGACATAGAGGGGCATGCTTCGCATTACACCATCCCATGGACCGAACTGATGG CAAAGGTCCCAGGCCTTAGCCCAGAGGCGCTGTGGAGAGAGGCAAATGTCACCGAAGATTTGGCGT CTATGCTTAACCGCTACAAGTTAATTTACAAGACGTCTGGTACCCTTGGTATTGCGCTGGCCGAGCCTG TCGATATCCCTGCTGTCTCTGAAGGATCCATGCAAGTGGATGCATCTAAGGTCCATCCCGGAGTCATTA GCGG...

Embodiment 2

[0085] Example 2 Screening and sequencing of antibodies

[0086] The menory B cells specifically combined with gH / gL protein were screened by flow cytometry.

[0087] (1) Materials and equipment

[0088] Anticoagulant peripheral blood of EBV infected patients; lymphocyte separation fluid; pH7.2 phosphate buffer saline (PBS, Thermo company); PBS-1% (wt / vol) BSA solution; fluorescent antibody CD3-PE-Cy5, CD16- PE-Cy5, CD235a-PE-Cy5, CD19-APC-Cy7, CD20-PE-Cy7, CD38-AF700, IgG-FITC (BD Biosciences); CD27-PB (Biolegend) CD14-PE-Cy5 (Thermo ); anti-his-PE fluorescent antibody (Miltenyi Biotec); His-tag labeled gH / gL protein (gH / gL-his protein); 96-well PCR plate (Axygen, USA); FACSAriaII flow cytometer (BD Corporation).

[0089] (2) Method

[0090] 1) Using Ficoll density gradient centrifugation to separate mononuclear cells (PBMC) from the peripheral blood (heparin anticoagulation) of EBV-infected patients;

[0091] 2) Count PMBC, take 1×10^7 cells and incubate with 100nMgH / gL...

Embodiment 3

[0097] Example 3 Sequencing and Expression Purification of Monoclonal Antibodies

[0098] The single B cell screened in Example 2 was lysed, cDNA was obtained by RT-PCR, and then the heavy chain and light chain specific primers were used to perform nested PCR respectively, and the antibody gene was sequenced.

[0099] Expression and purification of monoclonal antibodies.

[0100] The screened antibody heavy chain variable region upstream and CMV fragment, downstream and human IgG1 constant region and polyA fragment were subjected to overlapping PCR to obtain a fragment that could express the complete heavy chain; the screened antibody light chain variable region upstream Perform overlapping PCR with the CMV fragment, the downstream constant region of the light chain κ / λ, and the poly A fragment to obtain a fragment that can express the complete light chain. These two fragments were then constructed into the PMD18T (Takara) vector. The PMD18T plasmid containing the full-lengt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an antibody against Epstein-Barr virus for the first time, which is composed of a light chain and a heavy chain. The heavy chain variable region of the heavy chain has three complementary regions CDR1, CDR2 and CDR3, and their amino acid sequences are respectively shown in SEQ ID NO .1-3, the light chain variable region of the light chain has 3 complementary regions CDR1', CDR2' and CDR3', the amino acid sequences of which are respectively as SEQ ID NO.4, AAS, SEQ ID NO.5 shown. The antibody can block EBV infection of epithelial cells and B cells, the IC50 in epithelial cells is 120ng / ml, and the IC50 in B cells is 211ng / ml, but has no neutralizing effect on Ebola virus infection, indicating that the antibody It has a high ability to specifically neutralize EBV infection.

Description

technical field [0001] The invention relates to the technical field of antibodies, more specifically, to an IgG antibody neutralizing Epstein-Barr virus and its application. Background technique [0002] Epstein-Barr virus was first successfully cultivated and established from Burkitt lymphoma cells by Epstein and Barr in 1964. EBV belongs to the gamma subtype herpesviruses and was the first human oncogenic virus discovered. The infection of EBV in the crowd is very common, and it is reported that more than 95% of adults in the world carry EBV. In children and adolescents, EBV infection frequently causes infectious mononucleosis. EBV latent infection is related to the occurrence of various human lymphoid tumors and epithelial tumors, such as Hodgkin's lymphoma, Burkitt's lymphoma and NK / T cell lymphoma, etc. Epithelial tumors include nasopharyngeal carcinoma and about 10% of gastric cancer, etc. . For organ transplant patients and immunosuppressed patients such as AIDS p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K16/08C12N15/13C12N5/10A61K39/42A61P31/22
CPCC07K16/085A61P31/22C07K2317/565A61K2039/505
Inventor张林琦曾木圣单思思朱倩莹曹素梅
OwnerTSINGHUA UNIV