A method for preparing double-muscle rump cattle similar to natural mutant Belgian blue cattle
A technology of double-muscle buttocks and bi-allelic genes, which is applied in the biological field, can solve problems affecting functional research animals, biological safety issues, and different sizes and types of bi-allelic gene deletions, achieving obvious and stable phenotypes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1, sgRNA screening of MSTN biallelic mutation
[0049] In this study, MSTN gene knockout cattle were prepared using CRISPR / Cas9 combined with somatic cell cloning technology. Direct transfection of cells with Cas9 plasmids often has many disadvantages, such as random integration, introduction of resistance genes, and gene overexpression caused by multiple copy numbers. In view of this, the mRNA form of Cas9 is used to transfect cells: First, there is no possibility of random integration into host cells, which not only maintains the stability of the genetic information of the transfected cells, but also avoids biosafety issues caused by the introduction of heterologous genes. The second problem is that since mRNA has a certain half-life, it controls gene expression and expression time to a certain extent, which will reduce the harm to cells (overexpression of genes, off-targeting effects, etc.). At the same time, in order to avoid the use of screening marker gen...
Embodiment 2
[0094] Example 2, Preparation of MSTN biallelic mutant bovine fetal fibroblast cell line and double-muscle rump cattle
[0095] 1. Preparation of MSTN biallelic mutant cells
[0096] 1. In vitro transcription of cas9 mRNA
[0097] The pX330 vector (purchased from Addgene) expresses cas9 protein.
[0098] Using the pX330 vector as a template, T7-Cas9-F: ttaatacgactcactatagGGAGAATGGACTATAAGGACCACGAC and T7-Cas9-R: GCGAGCTCTAGGAATTCTTAC were used as primers to amplify to obtain a PCR product, which is the gene encoding cas9 (SEQ ID NO: 6).
[0099] The above-mentioned cas9-encoding gene was transcribed in vitro to prepare the mRNA of cas9 protein by using the in vitro transcription and polyA kit of Ambion Company in the United States. The specific process was as follows:
[0100] a. In vitro transcription of mRNA (Ambion kit method)
[0101] 1) Prepare the mRNA system for in vitro transcription at room temperature:
[0102] Table 4 is the in vitro transcription mRNA system
...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



