Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for preparing double-muscle rump cattle similar to natural mutant Belgian blue cattle

A technology of double-muscle buttocks and bi-allelic genes, which is applied in the biological field, can solve problems affecting functional research animals, biological safety issues, and different sizes and types of bi-allelic gene deletions, achieving obvious and stable phenotypes

Active Publication Date: 2020-12-18
CHINA AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the mechanism is known, it is difficult to simulate and prepare this kind of "double-muscled hip" cattle through traditional gene targeting technology.
First, the efficiency of monoallelic knockout of MSTN by traditional gene targeting in cattle is very low, and biallelic knockout of MSTN is even more difficult
Second, at the same time, traditional gene targeting technology will introduce screening marker genes, which are very different from the natural double-muscle rump cow genome, and screening marker genes will cause biosafety problems
Third, it is difficult to obtain natural mutations such as pure 11bp or single-base mutations through traditional gene targeting technology.
[0006] With the continuous development of artificial nucleases (ZFNs / TALENs / Cas9), the biallelic gene knockout technology in large animals has been greatly improved, and many MSTN gene knockout animals have also appeared. However, there are still many problems in these studies. First, There are also screening marker genes or artificial nuclease genes; second, the size and type of deletion of the two biallelic genes are different, which cause multiple transcripts in animals, affecting functional research and the animals themselves
These may be one of the reasons why there is no large animal with normal MSTN gene knockout

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for preparing double-muscle rump cattle similar to natural mutant Belgian blue cattle
  • A method for preparing double-muscle rump cattle similar to natural mutant Belgian blue cattle
  • A method for preparing double-muscle rump cattle similar to natural mutant Belgian blue cattle

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1, sgRNA screening of MSTN biallelic mutation

[0049] In this study, MSTN gene knockout cattle were prepared using CRISPR / Cas9 combined with somatic cell cloning technology. Direct transfection of cells with Cas9 plasmids often has many disadvantages, such as random integration, introduction of resistance genes, and gene overexpression caused by multiple copy numbers. In view of this, the mRNA form of Cas9 is used to transfect cells: First, there is no possibility of random integration into host cells, which not only maintains the stability of the genetic information of the transfected cells, but also avoids biosafety issues caused by the introduction of heterologous genes. The second problem is that since mRNA has a certain half-life, it controls gene expression and expression time to a certain extent, which will reduce the harm to cells (overexpression of genes, off-targeting effects, etc.). At the same time, in order to avoid the use of screening marker gen...

Embodiment 2

[0094] Example 2, Preparation of MSTN biallelic mutant bovine fetal fibroblast cell line and double-muscle rump cattle

[0095] 1. Preparation of MSTN biallelic mutant cells

[0096] 1. In vitro transcription of cas9 mRNA

[0097] The pX330 vector (purchased from Addgene) expresses cas9 protein.

[0098] Using the pX330 vector as a template, T7-Cas9-F: ttaatacgactcactatagGGAGAATGGACTATAAGGACCACGAC and T7-Cas9-R: GCGAGCTCTAGGAATTCTTAC were used as primers to amplify to obtain a PCR product, which is the gene encoding cas9 (SEQ ID NO: 6).

[0099] The above-mentioned cas9-encoding gene was transcribed in vitro to prepare the mRNA of cas9 protein by using the in vitro transcription and polyA kit of Ambion Company in the United States. The specific process was as follows:

[0100] a. In vitro transcription of mRNA (Ambion kit method)

[0101] 1) Prepare the mRNA system for in vitro transcription at room temperature:

[0102] Table 4 is the in vitro transcription mRNA system

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing double-muscle rump beef cattle similar to natural mutant Belgian blue cattle. The present invention provides a method for preparing MSTN biallelic mutant cells, in order to carry out genome editing on the target region of the first exon of the MSTN gene biallelic gene in the bovine fibroblast genome in vitro, so that the exon Exon 1 forms a stop codon in advance to terminate expression, and obtain MSTN biallelic mutant cells; the present invention establishes a method for preparing small fragment deletions of double MSTN alleles without any foreign DNA integration ( MSTN ‑4 / ‑4 ) knockout cattle, which, importantly, have a double-muscled hip phenotype very similar to naturally occurring Belgian blue cattle.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preparing double-muscle rump cattle similar to natural mutant Belgian blue cattle. Background technique [0002] With the continuous attention and strong support of the Chinese government to agricultural issues, my country's agricultural development has made great progress, especially the rapid development of the animal-related animal husbandry industry, which has greatly improved people's living conditions and dietary structure . Practices at home and abroad have shown that in the development of animal husbandry, the contribution rate of breeds has reached more than 40%. Therefore, animal breeding technology plays a vital and even irreplaceable role in promoting animal husbandry and even agricultural development. However, in my country, the main animal husbandry breeds are heavily dependent on imports. Among the main animal husbandry breeds, the dependence o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/90C12N15/877C12N15/85C12N5/10C12N15/12A01K67/027
CPCA01K67/0273A01K67/0276A01K2217/075A01K2227/101A01K2267/02C07K14/4703C07K14/475C12N5/0656C12N15/8509C12N15/8771C12N15/907C12N2510/00C12N2800/107
Inventor 王明孙照霖丁方荣王海萍戴蕴平
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products