Prawn growth related SNP markers and application thereof in breeding

A shrimp and marker technology, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, biochemical equipment and methods, etc., can solve the problems of small number of SNP markers, unclear analysis of growth traits, and inability to finely position genes, etc., to improve Breeding progress, accelerated genetic selection progress, and the effect of high breeding accuracy

Active Publication Date: 2020-11-03
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology describes a new type of fish called Lampreya that grows well when fed certain chemical substances like lithium or nitrogen fertilizers. These chemical compounds help plants grow faster than traditional ways they did beforehand. By combining different types of DNA probes together, it becomes more precise overall, resulting in improved quality crops grown under controlled conditions. Overall, this innovations provide technical benefits to researchers working towards creation of higher-yielded crop species.

Problems solved by technology

This patented technical problem addressed in this patents relates to improving the efficiency and precision of selecting or creating new types of fish from wild populations such as Prawnfish that require specific factors like nutritional values during their culture process. Current approaches involve studying individual characters over time but they lack sufficient detail about how each character affects its own performance on other aspects. Therefore there needs further improvements towards understanding and identifying key players involved in growing up crops.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prawn growth related SNP markers and application thereof in breeding
  • Prawn growth related SNP markers and application thereof in breeding
  • Prawn growth related SNP markers and application thereof in breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Obtaining of a group of SNP markers related to the growth of prawns

[0032] (1) Construction and trait determination of shrimp analysis population

[0033] The shrimp population used for analysis (Litopenaeus vannamei) was established in Hainan Guangtai Ocean Breeding Co., Ltd. in 2015. This population contains 13 full-sib families of shrimp. The establishment periods of these families are basically similar. Different families were cultured separately. After the family grew to about 3cm, 50 individuals were randomly selected from each family for VIE fluorescent labeling (NMT Company, USA), and the labeled shrimp were cultured under the same conditions. After 3 months of breeding, random selection The body weight of 200 individuals was measured, and the sex of the individuals was recorded.

[0034] (2) Sample DNA extraction

[0035] Use the Plant Genome Extraction Kit (Tiangen, Beijing) to extract the muscle tissue DNA of the above 200 individuals. For t...

Embodiment 2

[0085] Example 2: Application of SNP2570_399791 marker in breeding

[0086] (1) Sources of breeding materials

[0087] The group used for analysis (Litopenaeus vannamei) was constructed at Hainan Guangshun Taipu Marine Breeding Co., Ltd. This group is a mixture of multiple families with the same breeding environment. After 3 months of breeding, 300 individuals were randomly selected , take the last pair of swimming feet for DNA extraction.

[0088] (2) Sample DNA extraction

[0089] The plant genome extraction kit (Tiangen, Beijing) was used to extract DNA from the above 300 individual tissues. For specific operation steps, refer to the kit instruction manual. The concentration of each individual DNA was measured using a nucleic acid concentration analyzer Nanodrop 1000, and detected by agarose gel electrophoresis. DNA integrity. (3) Marker typing of SNP2570_399791

[0090] Use primers to amplify the target sequence amplified by SNP2570F: CGAAATGCGAATCAGCCTTGA and SNP2570R...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular marker-assisted breeding of aquatic animals, and particularly relates to a group of prawn growth related SNP markers and an application thereof in breeding. The growth related markers are shown as sequences SNP3085_190487, SNP1678_860109, SNP3406_465799 and SNP2570_399791, the marked dominant genotypes of the growth related markers are CC, GG, GG andCC respectively, and the growth speed of prawns can be remarkably increased by performing genotyping and marker selection on one or more SNP markers. The invention also discloses an application of the growth related markers in genetic breeding. Compared with a traditional breeding method, the method has the advantages that character-related molecular markers are used for assisting in breeding, and accuracy and high efficiency are achieved; and besides, the multiple markers can be used in a combined mode, rapid improvement of growth characters is achieved through marker polymerization, and themethod has wide application prospects in cultivation of high-yield varieties.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI