Method for classifying plant material

A plant material, amplification product technology, applied in the field of plant material classification, can solve the problems of discarding, low quality of tobacco batch or batch, etc.

Pending Publication Date: 2021-01-05
PHILIP MORRIS PROD SA
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, a tobacco lot or batch containing tobacco derived from any tobacco seed other than commercially prepared tobacco seed already sold to farmers may be of poor quality and may have to be discarded

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0144] Example 1: Method for amplifying the common tobacco trnH-psbA chloroplast intergenic spacer PCR primers were designed to amplify the common tobacco trnH-psbA chloroplast intergenic spacer (GenBank accession number FJ493313.1).

[0145] SEQ ID NO: 1 - Nicotiana vulgaris trnH-psbA chloroplast intergenic spacer (GenBank Accession No. FJ493313.1). The positions of the amplification primers are underlined.

[0146] ACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTT GATCCACTTGGCTACATCCGCCCCCTCGCCTACTTACATTCCGTTTTTA CATTATTTAAATT AGAAAAACAAAAGATTCAAGTTCG AATATAGCTCTTCTTTCTTATTTCAATGATATTATTATTTCAAAGATAAGAGATATTCAAA GATAAGAGATAAGAAGAAGTCAAAATTTGATTTTTTTTTTGGAAAAA AAAAATCAAAAAGATATAGTAACATTAGCAAGAAGAGAAACAAGTTC TATTTCTACAATTTTAAACAAATACAAAATCAAAATAGAATACTCAAT CATGAATAAAT GCAAGAAAATAACCTTCTCCTTC TTTTTCTATAATGTA AACAAAAAAGTCTATGTAAGTAAAATACTAGTAAATAAATAAAAAGA AAAAAAGAAAGGAGCAATAGCACCCTCTTGATAGAACAAGAAAATG ATTATTGCTCCTTTCTTTTCAAAACCTCCTAGACTAGGCCAGGATCT TATCCATTTGTAGATGGAGCTTCGATAGCAG...

Embodiment 2

[0162] Example 2: Analysis of tobacco batches using the common tobacco trnH-psbA chloroplast intergenic spacer

[0163] Tobacco lots of common tobacco are obtained from tobacco farmers who have been provided with seeds of sterile tobacco hybrids. Polynucleotides were extracted from tobacco batches and analyzed using the method described in Example 1.

[0164] Testing of various tobacco batches revealed that at least one of these tobacco batches had a common tobacco trnH-psbA chloroplast intergenic spacer size of 206 bp, thereby indicating that the tobacco batch contained N. Seeds of sterile tobacco hybrids.

[0165] Testing of various tobacco batches revealed that at least one of these tobacco batches had a common tobacco trnH-psbA chloroplast intergenic spacer size of 238 bp, thereby indicating that the tobacco batch contained Nicotiana indigo cytoplasm and was derived only from Seeds of sterile tobacco hybrids.

[0166] Testing of various tobacco batches revealed that at ...

Embodiment 3

[0167] Embodiment 3: The method for amplifying common tobacco trnL-trnF chloroplast intergenic region

[0168] PCR primers were designed to amplify the common tobacco trnL-trnF chloroplast intergenic spacer (GenBank accession number AH003085.2).

[0169] SEQ ID NO: 5 - Nicotiana vulgaris trnL-trnF chloroplast intergenic spacer (GenBank Accession No. AH003085.2). The positions of the amplification primers are underlined.

[0170] TCAATGGTTCCAGTATAAATGAAAGAAAAAGAAAAAGGAATGAC ATCACAACGAGATCCTAATCTCAAAAAGAAAGGGGGATATGGCGAAA TCGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACT TACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAA AATGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAACAAACAAAGG TTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAA CAAATGGAGTTAAAT GCGTTGGTAGAGGAATCTTTACATCGAAACTTC AGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTAT TGAATACTATATCAAAATCAAATGATTAATGATGACCCGAATCTGTAT TTTTTCTATAAAAAATAGAAGAATTGGTGTGAATCGATTCTACATTGA AGAAAGAATCGAATATTCATTGATCAAACCATTCACTCCATAGTCTGA TAGATCTTTTGAAGAACTGATTAAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
purityaaaaaaaaaa
Login to view more

Abstract

There is described herein a method for classifying a batch of plant material as either being contaminated or non-contaminated, the method comprising: (i) providing a sample of polynucleotide from thebatch of plant material; (ii) contacting the sample of polynucleotide with one or more amplification primers to amplify a target polynucleotide sequence associated with sterility; (iii) performing anin vitro polynucleotide amplification reaction on the sample to generate one or more amplification products; (iv) determining the size or sequence of the amplification product(s); and (v) based on thesize or sequence of the amplification product(s) determined in step (iv) comparing the size or sequence of the amplification product(s) with the size or sequence of known amplification product(s) from known genetic sources of sterility, wherein if the genetic source of sterility determined in step (v) corresponds to the expected genetic source of sterility of the batch of plant material then saidbatch of plant material is considered to be non-contaminated; or if the genetic source of sterility determined in step (v) does not correspond to the expected genetic source of sterility of the batchof plant material then said batch of plant material is considered to be contaminated.

Description

technical field [0001] The present disclosure generally relates to classifying a batch of plant material as contaminated or uncontaminated. The classification is based on analysis of one or more polynucleotide sequences associated with sterility. By performing the methods described herein, it is possible to determine whether a batch or batch of plant material is contaminated or uncontaminated to ensure the quality or integrity of the plant material. In particular, the present disclosure makes it easy to determine whether a batch of plant material has been adulterated. Background technique [0002] Commercially prepared tobacco seeds are sold to farmers for growing tobacco plants. In order to ensure the quality of the tobacco produced, it is generally desirable for producers of the seeds to be able to test the tobacco plants or tobacco products derived therefrom to check that they were derived from the tobacco seeds provided to farmers. Seed producers also expect to be abl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895
CPCC12Q1/6895C12Q2600/13
Inventor N·J-P·O·巴卡赫
Owner PHILIP MORRIS PROD SA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap