Method for classifying plant material
A plant material, amplification product technology, applied in the field of plant material classification, can solve the problems of discarding, low quality of tobacco batch or batch, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0144] Example 1: Method for amplifying the common tobacco trnH-psbA chloroplast intergenic spacer PCR primers were designed to amplify the common tobacco trnH-psbA chloroplast intergenic spacer (GenBank accession number FJ493313.1).
[0145] SEQ ID NO: 1 - Nicotiana vulgaris trnH-psbA chloroplast intergenic spacer (GenBank Accession No. FJ493313.1). The positions of the amplification primers are underlined.
[0146] ACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTT GATCCACTTGGCTACATCCGCCCCCTCGCCTACTTACATTCCGTTTTTA CATTATTTAAATT AGAAAAACAAAAGATTCAAGTTCG AATATAGCTCTTCTTTCTTATTTCAATGATATTATTATTTCAAAGATAAGAGATATTCAAA GATAAGAGATAAGAAGAAGTCAAAATTTGATTTTTTTTTTGGAAAAA AAAAATCAAAAAGATATAGTAACATTAGCAAGAAGAGAAACAAGTTC TATTTCTACAATTTTAAACAAATACAAAATCAAAATAGAATACTCAAT CATGAATAAAT GCAAGAAAATAACCTTCTCCTTC TTTTTCTATAATGTA AACAAAAAAGTCTATGTAAGTAAAATACTAGTAAATAAATAAAAAGA AAAAAAGAAAGGAGCAATAGCACCCTCTTGATAGAACAAGAAAATG ATTATTGCTCCTTTCTTTTCAAAACCTCCTAGACTAGGCCAGGATCT TATCCATTTGTAGATGGAGCTTCGATAGCAG...
Embodiment 2
[0162] Example 2: Analysis of tobacco batches using the common tobacco trnH-psbA chloroplast intergenic spacer
[0163] Tobacco lots of common tobacco are obtained from tobacco farmers who have been provided with seeds of sterile tobacco hybrids. Polynucleotides were extracted from tobacco batches and analyzed using the method described in Example 1.
[0164] Testing of various tobacco batches revealed that at least one of these tobacco batches had a common tobacco trnH-psbA chloroplast intergenic spacer size of 206 bp, thereby indicating that the tobacco batch contained N. Seeds of sterile tobacco hybrids.
[0165] Testing of various tobacco batches revealed that at least one of these tobacco batches had a common tobacco trnH-psbA chloroplast intergenic spacer size of 238 bp, thereby indicating that the tobacco batch contained Nicotiana indigo cytoplasm and was derived only from Seeds of sterile tobacco hybrids.
[0166] Testing of various tobacco batches revealed that at ...
Embodiment 3
[0167] Embodiment 3: The method for amplifying common tobacco trnL-trnF chloroplast intergenic region
[0168] PCR primers were designed to amplify the common tobacco trnL-trnF chloroplast intergenic spacer (GenBank accession number AH003085.2).
[0169] SEQ ID NO: 5 - Nicotiana vulgaris trnL-trnF chloroplast intergenic spacer (GenBank Accession No. AH003085.2). The positions of the amplification primers are underlined.
[0170] TCAATGGTTCCAGTATAAATGAAAGAAAAAGAAAAAGGAATGAC ATCACAACGAGATCCTAATCTCAAAAAGAAAGGGGGATATGGCGAAA TCGGTAGACGCTACGGACTTAATTGGATTGAGCCTTGGTATGGAAACT TACTAAGTGATCACTTTCAAATTCAGAGAAACCCTGGAATTAACAAA AATGGGCAATCCTGAGCCAAATCCTGTTTTCCGAAAACAAACAAAGG TTCAGAAAAAAAGGATAGGTGCAGAGACTCAATGGAAGCTATTCTAA CAAATGGAGTTAAAT GCGTTGGTAGAGGAATCTTTACATCGAAACTTC AGAAAGAAAAAGAATGAAGTGAAGGATAAACGTATATACATACGTAT TGAATACTATATCAAAATCAAATGATTAATGATGACCCGAATCTGTAT TTTTTCTATAAAAAATAGAAGAATTGGTGTGAATCGATTCTACATTGA AGAAAGAATCGAATATTCATTGATCAAACCATTCACTCCATAGTCTGA TAGATCTTTTGAAGAACTGATTAAT...
PUM
| Property | Measurement | Unit |
|---|---|---|
| length | aaaaa | aaaaa |
| purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com