Unlock instant, AI-driven research and patent intelligence for your innovation.

Epitope polypeptide and virus vector combination for inducing immunity

An epitope peptide, carrier technology, applied in the direction of viruses/phages, viruses, viral peptides, etc., can solve the problems of immune cross-reaction and weak protection, and achieve the effect of stable compatibility and balancing cellular and humoral immunity.

Active Publication Date: 2021-09-21
SHANTOU UNIV MEDICAL COLLEGE
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Because there are many types of enteroviruses, the immune cross-reaction and protection between different types of enteroviruses are very weak, so it is difficult to use a single type of vaccine to provide immune protection against a variety of popular enteroviruses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Epitope polypeptide and virus vector combination for inducing immunity
  • Epitope polypeptide and virus vector combination for inducing immunity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] (1) Obtaining the gene fragment whose sequence number is SEQ ID No.2:

[0028] The biosynthetic company uses whole gene synthesis or long primer splicing to obtain the gene fragment SEQ ID No.2 encoding the epitope polypeptide shown in SEQ ID No.1. The sequence is codon-optimized and its sequence is: 5'

[0029]-ATGGCGAAACTGTCTACTGATGAACTGCTGGATGCATTCAAAGAGATGACCCTGCTGGAACTGTCCGATTTCGTTAAGAAATTCGAGGAAACCTTTGAAGTGACCGCAGCTGCGCCGGTTGCAGTTGCTGCTGCCGGCGCTGCGCCAGCGGGTGCAGCGGTTGAGGCAGCGGAAGAACAAAGCGAGTTCGACGTAATTCTGGAGGCAGCGGGCGACAAGAAAATTGGTGTAATCAAAGTAGTGCGTGAGATTGTGAGCGGTCTGGGCCTGAAAGAGGCGAAGGACCTGGTAGATGGTGCGCCGAAACCGCTGCTGGAGAAGGTTGCTAAGGAGGCGGCCGATGAAGCCAAAGCTAAACTGGAGGCAGCCGGCGCAACTGTTACCGTTAAAGAAGCGGCTGCGAAAGTTCCGCCGGGTGCGCCGAAGCCGGATAGCCGCGAGAGCCTGGCTTGGAAGAAACCAACCTTTGGCGAACACAAACAGGAGAAAGATCTGGAGTACGGCGCTGCCGCGTACTCCATGATCAATAACATTATCATCCGTGCCGCATACATCTCCAAATTCATTGACTGGCTGAAGGGTCCAGGCCCAGGCCCGGCTTCTGCATACCAGTGGTTTTATGATGGCTACCCGACCTTCGGTCCGGGTCCGGGCGTTCGCATCTACATGCGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an epitope polypeptide and viral vector combination for inducing immunity, and belongs to the technical field of biology. The invention provides an epitope polypeptide which is derived from a plurality of enteroviruses and has an immune protection biological effect, a gene for coding the epitope polypeptide is loaded on a modified coxsackie B3 type virus vector, and foreign protein can be successfully expressed in cells after the coxsackie B3 type virus vector is injected; the optimized epitope polypeptide is combined with the virus vector, so that compared with the single use of the recombinant epitope polypeptide, the immune response to various viruses can be more effectively induced; after the epitope polypeptide is combined with the virus vector, the gene segment coded by the epitope polypeptide has stable compatibility with the virus vector, and has good hereditary stability.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a combination of an epitope polypeptide and a virus carrier for inducing immunity. Background technique [0002] Enteroviruses are a group of viruses belonging to the genus Enterovirus in the family Picornaviridae, which can infect children and adults, especially posing a great threat to children's health and public health. Among them, the viruses of the Enterovirus genus that pose a greater threat to children mainly include the new enterovirus EV71 type, Coxsackie virus A16 type, Coxsackie virus A6 type, etc. After these viruses infect children, they will cause hand, foot and mouth disease, Herpetic angina and other diseases, severe viral infection can cause central nervous system complications, including encephalitis, encephalopathy, etc. [0003] Because there are many types of enteroviruses, the immune cross-reaction and protection between different types of enterovi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/085C12N15/41C12N7/01A61K39/125A61P31/14C12R1/93
CPCC07K14/005C12N7/00A61K39/12A61P31/14C12N2770/32322C12N2770/32334C12N2770/32021C12N2770/32034A61K2039/5256A61K2039/70Y02A50/30
Inventor 王革非邓辉雄谷李铭李雁嫘宋鑫利王婷婷何绚婷代剑平李蕊
Owner SHANTOU UNIV MEDICAL COLLEGE