Epitope polypeptide and virus vector combination for inducing immunity
An epitope peptide, carrier technology, applied in the direction of viruses/phages, viruses, viral peptides, etc., can solve the problems of immune cross-reaction and weak protection, and achieve the effect of stable compatibility and balancing cellular and humoral immunity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] (1) Obtaining the gene fragment whose sequence number is SEQ ID No.2:
[0028] The biosynthetic company uses whole gene synthesis or long primer splicing to obtain the gene fragment SEQ ID No.2 encoding the epitope polypeptide shown in SEQ ID No.1. The sequence is codon-optimized and its sequence is: 5'
[0029]-ATGGCGAAACTGTCTACTGATGAACTGCTGGATGCATTCAAAGAGATGACCCTGCTGGAACTGTCCGATTTCGTTAAGAAATTCGAGGAAACCTTTGAAGTGACCGCAGCTGCGCCGGTTGCAGTTGCTGCTGCCGGCGCTGCGCCAGCGGGTGCAGCGGTTGAGGCAGCGGAAGAACAAAGCGAGTTCGACGTAATTCTGGAGGCAGCGGGCGACAAGAAAATTGGTGTAATCAAAGTAGTGCGTGAGATTGTGAGCGGTCTGGGCCTGAAAGAGGCGAAGGACCTGGTAGATGGTGCGCCGAAACCGCTGCTGGAGAAGGTTGCTAAGGAGGCGGCCGATGAAGCCAAAGCTAAACTGGAGGCAGCCGGCGCAACTGTTACCGTTAAAGAAGCGGCTGCGAAAGTTCCGCCGGGTGCGCCGAAGCCGGATAGCCGCGAGAGCCTGGCTTGGAAGAAACCAACCTTTGGCGAACACAAACAGGAGAAAGATCTGGAGTACGGCGCTGCCGCGTACTCCATGATCAATAACATTATCATCCGTGCCGCATACATCTCCAAATTCATTGACTGGCTGAAGGGTCCAGGCCCAGGCCCGGCTTCTGCATACCAGTGGTTTTATGATGGCTACCCGACCTTCGGTCCGGGTCCGGGCGTTCGCATCTACATGCGC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

