Unlock instant, AI-driven research and patent intelligence for your innovation.

Rice insect-resistant microRNA and application thereof

A rice, insect resistance technology, applied in the direction of DNA / RNA fragments, application, recombinant DNA technology, etc., can solve the problems of thin and narrow rice seeds, reduce rice yield, etc.

Pending Publication Date: 2021-10-29
SUN YAT SEN UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, overexpression of osa-miR162a in rice can silence the expression of rice endogenous gene OsDCL1 and other genes, resulting in narrower rice seeds and reduced rice yield.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice insect-resistant microRNA and application thereof
  • Rice insect-resistant microRNA and application thereof
  • Rice insect-resistant microRNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1. Manually optimize the design of amiRNA

[0034] miRNAs usually bind to their base-paired target mRNAs, degrading them or inhibiting their translation. But in reality, most natural miRNAs are only partially complementary to target mRNAs. It can be seen from the prediction that osa-miR162a (UCGAUAAACCUCUGCAUCCAG) targets the CDS region near the 5' end of NlTOR gene in N. lugens. Among the 21 bases of Osa-miR162a, 15 bases were complementary paired with NlTOR gene.

[0035] The applicant optimizes osa-miR162a according to the following strategies (such as figure 1 Shown): 1. Increase the complementary pairing between artificially optimized osa-miR162a-m1 (osa-miR162a-m1) and NlTOR gene, and improve its binding ability with NlTOR gene; 2. Reduce the prediction of osa-miR162a-m1 number of rice genes bound, while ensuring that osa-miR162a-m1 does not target human genes. After screening, we obtained osa-miR162a-m1, which has 17 bases that are complementary to the NlTOR ge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice insect-resistant microRNA and application thereof. The nucleotide sequence of osa-miR162a-m1 is tcaataaactgctgcacccag. The invention aims to reduce silencing of rice endogenous genes and maintain effective inhibition of NlTOR gene expression by manually optimizing osa-miR162a. Through optimization, the rice endogenous genes are not inhibited by the optimized osa-miR162a-m1 any more, the influence of the osa-miR162a on rice growth and development is restored, and meanwhile the egg laying amount and hatching rate of brown planthopper can still be effectively reduced.

Description

Technical field: [0001] The invention belongs to the field of biotechnology, and in particular relates to a rice insect-resistant microRNA and its application. Background technique: [0002] Brown planthopper is one of the most important pests that harm rice production. It sucks the leaf sheath or leaves at the base of rice stems through its mouthparts, directly feeds on rice juice, and can also spread bacteria, fungi, and viruses to cause secondary damage to rice. The existing method of preventing and controlling the harm of brown planthopper is mainly by spraying chemical pesticides. Although this method is efficient and fast, large-scale spraying of pesticides is likely to cause environmental pollution, and it will kill other beneficial insects indiscriminately and destroy the ecology. Therefore, it is of great practical significance to develop a new low-toxic, high-efficiency, non-residue-free method that can specifically control BPH. [0003] In recent years, more and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/46
CPCC12N15/1138C12N15/8218C12N15/8286C12N2310/141C12N2310/531Y02A40/146
Inventor 李剑峰沈文忠张文庆
Owner SUN YAT SEN UNIV