Rice insect-resistant microRNA and application thereof
A rice, insect resistance technology, applied in the direction of DNA / RNA fragments, application, recombinant DNA technology, etc., can solve the problems of thin and narrow rice seeds, reduce rice yield, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] 1. Manually optimize the design of amiRNA
[0034] miRNAs usually bind to their base-paired target mRNAs, degrading them or inhibiting their translation. But in reality, most natural miRNAs are only partially complementary to target mRNAs. It can be seen from the prediction that osa-miR162a (UCGAUAAACCUCUGCAUCCAG) targets the CDS region near the 5' end of NlTOR gene in N. lugens. Among the 21 bases of Osa-miR162a, 15 bases were complementary paired with NlTOR gene.
[0035] The applicant optimizes osa-miR162a according to the following strategies (such as figure 1 Shown): 1. Increase the complementary pairing between artificially optimized osa-miR162a-m1 (osa-miR162a-m1) and NlTOR gene, and improve its binding ability with NlTOR gene; 2. Reduce the prediction of osa-miR162a-m1 number of rice genes bound, while ensuring that osa-miR162a-m1 does not target human genes. After screening, we obtained osa-miR162a-m1, which has 17 bases that are complementary to the NlTOR ge...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


