Food-grade streptococcus thermophilus expression system and application thereof in yogurt preparation
A Streptococcus thermophilus, expression system technology, applied in the food-grade Streptococcus thermophilus expression system and its application in yogurt preparation, can solve the problems of increasing the cost of use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0087] The construction of food-grade host Streptococcus thermophilus CH3070 comprises the following steps:
[0088](1) Inoculate Streptococcus thermophilus JIM8232 in LM17 liquid medium, collect the bacteria after static culture at 42°C overnight, and extract genomic DNA using a bacterial genome extraction kit; LM17 medium contains 2.5 g of animal peptone per liter, Tryptone 2.5g, soybean peptone 5g, beef extract 5g, yeast extract 2.5g, ascorbic acid 0.5g, magnesium sulfate 0.25g, beta-sodium glycerophosphate pentahydrate 19g, lactose 20g, and the balance water.
[0089] (2) Using the genomic DNA of step (1) as a template, using the nucleotide sequence as primers of SEQ ID NO.1 and SEQ ID NO.2 to perform PCR on ST-LacS-up-F and ST-LacS-up-R Amplify the upstream homology arm of the lactose permeating enzyme gene STlacS,
[0090] ST-LacS-up-F: ggtaccgggccccccctcgagTTCCAACGGAAACTGGTGCT SEQ ID NO.1
[0091] ST-LacS-up-R:TTCGGAAACCCTCCTATTATTTG SEQ ID NO.2
[0092] The PCR ampl...
Embodiment 2
[0110] Food grade expression vector pST5240
[0111] The food-grade expression vector pST5240 contains the following elements: the replication element from the plasmid pMG36e, the P ldh promoter and T ldh terminator, and the lactose permeating enzyme LPlacS gene derived from Lactobacillus plantarum WCFS1. Its spectrum is as figure 2 As shown, the sequence was synthesized by Shanghai Sangon Bioengineering Co., Ltd., and the nucleotide sequence is shown in SEQ ID NO.7. After the synthetic expression vector pST5240 was transformed into Streptococcus thermophilus CH3070, its growth in LM17 medium was not only restored, but also exceeded the level of wild-type JIM8232 bacteria, as shown in image 3 , and further analyzed the lactose metabolism in the medium, compared with the wild-type strain, the galactose content in the medium was reduced from 9.7g / L to 5.2g / L.
Embodiment 3
[0113] Application of the above food-grade Streptococcus thermophilus expression system in the production of gamma-aminobutyric acid in the process of yogurt preparation
[0114] The nucleotide sequence is the primer pair gad-F and gad-R of SEQ ID NO.8 and SEQ ID NO.9 to amplify the Lactobacillus pumilus glutamic acid decarboxylase gene gad, and the amplified product is double-digested with NdeI and BamHI , and the vector pST5240 was double-digested with NdeI and BamHI, and the digested product was digested with T 4 The DNA polymerase was connected, and the ligation product was transformed into Streptococcus thermophilus CH3070, and the transformants were screened on LM17 medium, and the plasmids extracted from the screened transformants were verified. In the milk of sodium glutamate, after culturing at 42°C for 12 hours, the content of γ-aminobutyric acid in the fermented yoghurt was determined, and the results were as follows: Figure 4 shown.
[0115] gad-F:GCGCATATGGCTA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More