A food-grade Streptococcus thermophilus expression system and its application in yoghurt preparation
A Streptococcus thermophilus, expression system technology, applied in the food-grade Streptococcus thermophilus expression system and its application in yoghurt preparation, can solve the problems of increasing the cost of use, and achieve the promotion of synthesis, the reduction of galactose content, good Applied effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0087] The construction of food-grade host Streptococcus thermophilus CH3070 includes the following steps:
[0088](1) Inoculate Streptococcus thermophilus JIM8232 in LM17 liquid medium, collect the cells after static culture at 42°C overnight, and use a bacterial genome extraction kit to extract genomic DNA; each liter of LM17 medium contains: animal peptone 2.5g, Tryptone 2.5g, soybean peptone 5g, beef extract 5g, yeast extract 2.5g, ascorbic acid 0.5g, magnesium sulfate 0.25g, beta-glycerophosphate sodium pentahydrate 19g, lactose 20g, balance water.
[0089] (2) Using the genomic DNA of step (1) as a template, PCR was performed on ST-LacS-up-F and ST-LacS-up-R with primers whose nucleotide sequences were SEQ ID NO.1 and SEQ ID NO.2 Amplify the upstream homology arm of the lactose permease gene STlacS,
[0090] ST-LacS-up-F: ggtaccgggccccccctcgagTTCCAACGGAAACTGGTGCT SEQ ID NO. 1
[0091] ST-LacS-up-R: TTCGGAAAACCTCCTATTATTTG SEQ ID NO. 2
[0092] PCR amplification system...
Embodiment 2
[0110] Food grade expression vector pST5240
[0111] The food-grade expression vector pST5240 contains the following elements: replication elements from plasmid pMG36e, P from S. thermophilus strain JIM8232 ldh promoter and T ldh terminator, and the lactose permease LPlacS gene derived from Lactobacillus plantarum WCFS1. Its graph is figure 2 As shown, the sequence was synthesized by Shanghai Sangon Bioengineering Co., Ltd., and the nucleotide sequence is shown in SEQ ID NO.7. After the synthetic expression vector pST5240 was transformed into Streptococcus thermophilus CH3070, its growth in LM17 medium was not only restored, but also exceeded the bacterial mass level of wild-type JIM8232. image 3 , and further analyzed the lactose metabolism in the medium. Compared with the wild-type strain, the galactose content in the medium was reduced from 9.7g / L to 5.2g / L.
Embodiment 3
[0113] Application of the above-mentioned food-grade Streptococcus thermophilus expression system in the production of γ-aminobutyric acid in the process of preparing yogurt
[0114] The Lactobacillus pumilus glutamate decarboxylase gene gad was amplified using the primer pairs gad-F and gad-R with nucleotide sequences of SEQ ID NO.8 and SEQ ID NO.9, and the amplified product was digested with NdeI and BamHI double enzymes , and the vector pST5240 was double digested with NdeI and BamHI, and the digested product was digested with T 4 DNA polymerase was ligated, the ligation product was transformed into Streptococcus thermophilus CH3070, the transformants were screened on LM17 medium, and the screened transformants were extracted with plasmids for verification. In milk with sodium glutamate, after culturing at 42 °C for 12 hours, the content of γ-aminobutyric acid in fermented yogurt was determined, and the results were as follows Figure 4 shown.
[0115] gad-F: GCGCATATGGC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More