Peronospora resistance in spinacia oleracea

A technology of spinach and resistance, which is applied in the field of spinach plants to produce spinach plants carrying the gene, and can solve the problems of poor knowledge of the R gene

Active Publication Date: 2021-10-29
RIJK ZWAAN ZAADTEELT & ZAADHANDEL BV
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although R genes are widely used in spinach breeding, little is known about these R genes until now

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peronospora resistance in spinacia oleracea
  • Peronospora resistance in spinacia oleracea
  • Peronospora resistance in spinacia oleracea

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] Testing Spinach Plants for Resistance to Downy mildew spinach specific

[0090] Resistance to downy mildew infection was determined using differential sets as described by Irish et al. (2008; Phytopathol. 98:894-900). Spinach plants of the present invention were sown together with spinach plants from various other genotypes (see Table 3) in trays containing Scotts Redi-Earth medium and fertilized with Osmocote Peter's (13-13-13) fertilizer after emergence of seedlings ( Scotts) fertilized twice a week. The plants were inoculated with the sporangia suspension (2.5×10 5 / ml). In this way, 4 officially recognized pathogenic races were tested.

[0091] The inoculated plants were placed in a dew room at 18°C ​​with 100% relative humidity for 24 hours and then moved to a growth chamber at 18°C ​​with a 12 hour photoperiod for 6 days. After 6 days, plants were returned to the open room for 24 h to induce sporulation and scored for disease response.

[0092] Plants used for...

Embodiment 2

[0098] Amplification of LRR domain coding regions

[0099] Using the forward primer ACAAGTGGATGTGTCTTAGG (SEQ ID No: 1) and the reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID No: 2), isolated genomic DNA of spinach plants containing the α-WOLF 25 allele (representative samples of their seeds are given in NCIMB Accession No. 43495 (deposited at NCIMB) for polymerase chain reaction (PCR). The primer pair amplifies the LRR domain coding region of the α-WOLF gene and was designed to selectively amplify portions of the WOLF gene but not other CC-NBS-LRR protein-coding genes.

[0100] The PCR conditions for amplifying the LRR domain coding region of the α-WOLF gene using primers having SEQ ID No: 1 and SEQ ID No: 2 are as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

[0101] - 3 minutes at 95°C (initial denaturation step)

[0102] - 40 amplification cycles, each consisting of: denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°...

Embodiment 3

[0117] Introduction of the α-WOLF 25 allele in plants that do not carry the allele

[0118] Spinach plants containing the α-WOLF 25 allele (a representative seed sample of which was deposited with NCIMB under NCIMB accession number 43495) were crossed with plants of the variety Viroflay carrying the β-WOLF 0 allele to obtain the F1 generation. Subsequently, F1 plants were selfed to obtain F2 populations.

[0119] Plants of the F2 population were assayed for resistance to Peronola farinae Pfs:16 as described in Example 1. In the assay, approximately 75% of the plants scored as fully resistant. This segregation pattern is consistent with that of dominant inheritance.

[0120] Genomic DNA from each plant of the same F2 population was isolated and used in two different polymerase chain reactions (PCR). The first PCR reaction was performed using primers for amplifying the LRR domain of the α-WOLF allele, and the second PCR reaction was performed using primers for amplifying the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an allele designated alpha-WOLF 25 which confers resistance to at least one Peronospora farinosa f. sp. spinacea race, wherein the protein encoded by the allele is a CC-NBS-LRR protein that comprises in its amino acid sequence: a) the motif "MAEIGYSVC" at its N-terminus; and b) the motif "KWMCLR"; and wherein the LRR domain of the protein has in order of increased preference at least 95%, 96%, 97%, 98%, 99%, 100% sequence similarity to SEQ ID No:5. The allele, when present in a spinach plant, confers complete resistance to at least Peronospora farinosa f. sp. spinacea race Pfs:8, Pfs15 and Pfs:16, and does not confer resistance to Pfs:3.

Description

[0001] field of invention [0002] The present invention relates to genes capable of conferring resistance to spinach plants against one or more Peronospora farinosa f. sp. Spinaciae races. The invention also relates to spinach plants, propagation material of said spinach plants, cells of said spinach plants and seeds of said spinach plants carrying the gene. The invention further relates to methods for producing spinach plants carrying the gene and the use of the gene in breeding to confer specialized resistance to spinach against downy mildew. [0003] Background of the invention [0004] Downy mildew (Pynorrhea spinach specific) is a major threat to spinach growers because it directly affects harvested leaves. In spinach, downy mildew is caused by oomycete downy mildew spinach specific (formerly P. effusa). The infection renders the leaves unsuitable for sale and consumption, as it manifests itself phenotypically as yellow lesions on older leaves, and gray fungal growth can ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A01H5/12A01H1/04C07K14/415A01H6/02
CPCA01H5/12C07K14/415A01H6/028C12Q1/6895C12Q2600/156C12Q2600/13C12N15/8282
InventorR·J·J·M·弗里特斯V·L·A·考克
OwnerRIJK ZWAAN ZAADTEELT & ZAADHANDEL BV