Melanoma leptomeningeal metastasis model construction method

A technology of metastasis model and construction method, applied in the biological field, can solve the problem of lack of animal models of melanoma leptomeningeal metastasis, and achieve the effects of convenient cell analysis, sorting and observation, high success rate and stability, and low cost

Pending Publication Date: 2021-12-17
FUDAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still a lack of animal models of melanoma leptomeningeal metastasis, so there is an

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Melanoma leptomeningeal metastasis model construction method
  • Melanoma leptomeningeal metastasis model construction method
  • Melanoma leptomeningeal metastasis model construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] step 1:

[0032] In a cell culture dish with a diameter of 10 cm, the B16 melanoma cell line was cultured in RPMI-1640 complete medium (containing 10% FBS and 1% penicillin-streptomycin solution). In a cell culture dish with a diameter of 10 cm, 293T cell cultures were cultivated in DMEM complete medium (containing 10% FBS and 1% penicillin-streptomycin solution). The temperature of the cell culture incubator was 37 °C, CO 2 The concentration is 5%.

[0033] Step 2:

[0034] Using the pCDH-EF1-Luc2-T2A-Neo plasmid (concentration 100ng / μL) as a template, the Luciferase fragment was amplified by polymerase chain reaction (PCR) with the designed forward / reverse primers.

[0035] The base sequence of the forward primer is: 5'- CCTACTCTAGAGCTAGCGAATTCATGGAAG -3';

[0036] The base sequence of the reverse primer is: 5'- GAAGACTTCCTCTGCCCTCAG -3';

[0037] The PCR program used to amplify the Luciferase fragment is: 94°C pre-denaturation, 2 minutes; 94°C denaturation, 15 s...

Embodiment 2

[0051] In order to test the pial transfer ability of the screened B16-Luc2-CopGFP LM cells, we divided 5×10^ 4 Two B16-Luc2-CopGFPPar and B16-Luc2-CopGFP LM cells were injected into the left ventricle of mice, and the ability of the two kinds of cells to transfer to pia mater was observed and compared. Such as Figure 6 As shown, 15 days after cardiac injection, B16-Luc2-CopGFP LM cells diffused in large numbers in the pial space ( Figure 6 A), The screened B16-Luc2-CopGFP LM cells have a strong ability to metastasize to the pia mater. And all mice injected with B16-Luc2-CopGFP LM cells died within 20 days after cardiac injection ( Figure 6 B).

Embodiment 3

[0053] In order to further test the pial colonization ability of the screened B16-Luc2-CopGFP LM cells, we divided 2×10 4 B16-Luc2-CopGFPPar and B16-Luc2-CopGFP LM cells were injected into the cisterna magna of mice, and the survival of mice was observed and compared. Such as Figure 7 As shown, mice injected with B16-Luc2-CopGFP LM cells began to die 10 days after injection, and all died within two weeks, while no death was observed in mice injected with B16-Luc2-CopGFP Par cells. This indicated that the B16-Luc2-CopGFP LM cells screened for directional pial transfer had a high colonization ability in the pial space.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biology, and particularly relates to a melanoma leptomeningeal metastasis model construction method. The method comprises the following steps of culturing a melanoma cell strain and a 293T cell strain; performing lentivirus packaging; performing lentiviral infection; obtaining a luciferase and fluorescent protein co-expressed melanoma cell line; and constructing a melanoma leptomeningeal metastasis mouse model. Leptomeningeal metastasis (LM) is an important reason for death of melanoma patients. At present, no proper melanoma leptomeningeal metastasis mouse model exists. According to the method, the pathogenesis of melanoma leptomeningeal metastasis is deeply explored, and a new technical means and a leptomeningeal metastasis animal model are provided for treatment of cancer leptomeningeal metastasis.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for constructing a mouse model of melanoma leptomeningeal metastasis. Background technique [0002] Cancer is a major disease that threatens human life. According to the data released by the "Journal of Clinical Oncology" in 2021, there will be 19.3 million new cancer cases in the world in 2020 [1]. Melanoma usually refers to malignant melanoma, which is a highly malignant tumor derived from melanocytes. It mostly occurs in the skin, and can also be found in mucous membranes and internal organs[2, 3]. Its morbidity and mortality are increasing worldwide. Increase [4-6]. Surgical resection is the mainstay of treatment for melanoma at all stages, and treatment of advanced or metastatic melanoma is often combined with adjuvant therapy such as immunotherapy, radiotherapy, or chemotherapy [2, 7]. The death of melanoma patients is closely related to tumor metastasis[...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N5/09C12N5/10C12N15/867A01K67/027
CPCC12N5/0693C12N15/86A01K67/0271C12N2740/15043A01K2227/105A01K2267/0331
Inventor 迟喻丹张炜赵加旭彭海豹曾睿江一凡
Owner FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap