Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer, probe and identification method of hirsutella sinensis

A technology of Chinese Trichospora, identification method, applied in the field of bacterial identification, can solve the problem of not yet established molecular identification test standards and other problems

Pending Publication Date: 2021-12-24
NAT INST FOR FOOD & DRUG CONTROL
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The reason is that, on the one hand, no specific and easy-to-operate molecular identification test standards have been established. On the other hand, from the perspective of cost accounting, enterprises prefer microscopic morphology identification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe and identification method of hirsutella sinensis
  • Primer, probe and identification method of hirsutella sinensis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0018] The principles and features of the present invention are described below, and the examples given are only used to explain the present invention, and are not intended to limit the scope of the present invention.

[0019] In this implementation example, the following steps are included:

[0020] Take the ITS sequence of a representative sample of fermented Cordyceps sinensis powder (Hir.sin.) and use the IDTDNA website to design online primers and probes, compare the designed primers and probes with the sample sequence, and remove the public primers and probes , the remaining primers and probes were synthesized, screened and optimized.

[0021] Screen and optimize primers

[0022] PCR gel electrophoresis was used to screen and optimize the designed primers one by one. As a result, a pair of primers and probe sequences with better specificity were selected.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe and an identification method of hirsutella sinensis. The primer comprises specific primers 5 'CACCACAGCAGTTGCCT3 'and 5 ' TCATTTGCTTGCTTCTTGACTG3 ', and the probe is 5 'CCTGTCGCAGTGGCATCTCT-3 '. According to the primer, the probe and the identification method of the hirsutella sinensis, the specific primer and the probe of the hirsutella sinensis are designed, a real-time fluorescent PCR identification method of each sample is established after optimization, and the identification problem of fermented cordyceps sinensis medicinal materials is solved from the molecular level.

Description

technical field [0001] The invention belongs to the technical field of strain identification, and in particular relates to a primer, a probe and an identification method for Mortierella sinensis. Background technique [0002] Cordyceps sinensis, as a traditional precious Chinese herbal medicine, has a history of thousands of years in China. It is mainly produced in the Qinghai-Tibet Plateau and its Hengduan Mountains. It is called "Three Treasures of China". [0003] Due to the increasing scarcity of natural Cordyceps sinensis resources and the difficulty of popularizing artificially cultured Cordyceps sinensis in the market, most of the current research on fermented Cordyceps preparations focuses on the chemical components and pharmacological effects of the products. There are few single studies. The raw material of this type of product is fermented bacteria powder, which is obtained from the strains extracted and isolated from Cordyceps sinensis through submerged ferment...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/686C12Q1/04C12N15/11
CPCC12Q1/6895C12Q1/686C12Q2561/113C12Q2563/107C12Q2600/158
Inventor 张萍魏锋马双成崔生辉任秀康帅陆兔林
Owner NAT INST FOR FOOD & DRUG CONTROL