Application of morphine-dependent screening gene miR-124 and target protein IQGAP1 thereof
A miRNA-124 and target protein technology, applied in the field of morphine-dependent screening gene miR-124 and its target protein IQGAP1, can solve problems such as ignoring regulatory effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] This embodiment uses QPCR technology to screen morphine dependencies and its target protein.
[0017] The specific screening method is: collecting morphine dependence on patients and health controls of 40 cases of blood specimens, according to the severity of opioids (OASI) to evaluate the severity of opioid addiction to patients, detect the morphine dependency group and the control group blood QPCR MIR-124 IQGAP1 level, the result is shown in Table 1.
[0018] Table 1 comparison with the population statistics and clinical variables of the control group of morphine dependencies
[0019]
[0020] Table 1 shows that the MiRNA-124 content (Z = -3.017, P <0.001), the MiRNA-124 content (Z = -3.017, P <0.001), the comparison of the population statistics in the control group (Z = -3.999, P < 0.001) Below the control group.
[0021] Analysis of the independent influencing factors of the total score of the OASI dependence of morphine, the results are shown in Table 2.
[0022] Tab...
Embodiment 2
[0026] This embodiment also uses biofluotosenase to react the combination of genes and target proteins.
[0027] In order to verify whether the MIR-214 directly targets IQGAP1, first of all, the PGL6-iQGAP1 carrier is constructed. IQGAP1 target gene is synthesized by ELK Biotechnology Company.
[0028] IQGAP1 is extended through PCR and connected to the overlapping sequence of the carrier, and then reorganized with the digestive carrier.
[0029] Related information is as follows:
[0030] IQAP15'-3'Primer Sequences:
[0031] 135iqgap1 F: CCGTGTGTAAGAGTCCCCCCAGAGAGACATCTCCCA
[0032] 136iqgap1 R: CTCTCGAGAGAGGGGGGGGGAAGTGTGTGACTTTTTC
[0033] 137mir-124Sequence: CCGuaaguggcgcacggaau
[0034] Expansion PCR through variability, annealing and extended programs. After 30 minutes of reorganization of 37 ° C, use high -efficiency DH5A to feel the state cells for transformation. After 1 day, a single cloning is picked for sequencing testing, and a single colonies with correct sequencing ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


