Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Secretory expression for human insulin gene in methyl alcohol yeast

A technology of human insulin and methanol yeast, applied in the field of genetic engineering, can solve problems such as low expression level, and achieve the effects of increasing yield, simple process and shortening working hours

Inactive Publication Date: 2005-05-11
马延高 +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The technical problem to be solved by the present invention is: provide a kind of human insulin gene in methanol yeast (Pichia Pastoris) GS115 / pPICM # 101. Secretion expression in CCTCC NO.M204071 with the deposit number, which solves the defects of the low expression level of the expression gene obtained in the prior art and the need for extremely complicated processes such as transpeptide removal of the C chain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Secretory expression for human insulin gene in methyl alcohol yeast
  • Secretory expression for human insulin gene in methyl alcohol yeast
  • Secretory expression for human insulin gene in methyl alcohol yeast

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0060] The present invention will be further described below in conjunction with embodiment, as shown in Figure 5, the present invention specifically comprises the following steps:

[0061] Step 1: Construction of expression plasmid pPIC9K(+B+A):

[0062] 1. Preparation of plasmid pPIC9K (B-C'-A) containing 2-peptide C-chain human proinsulin (B-C'-A).

[0063] The molecular biology operations involved in the present invention are all carried out according to conventional classical methods (Ausubel, F.M., et al., Short Protocols in Molecular Biology Second Edition, 1992).

[0064] a) Preparation of B-C'-A DNA fragment: using the yeast preferred codon human proinsulin (C') sequence (Figure 1). Synthesize the following two single-stranded DNA fragments of similar primers at Integrated DNA Technologies, Inc. in the United States:

[0065] 5'-USAp (100nt)

[0066] 5'- GCATTACGTA TTCGTTAACCAACACTTGTGTGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTT TCTTTCTACACTCCAA AGACT

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention was involved in expression of human insulin gene, especially for the expression of human insulin gene in Pichia Pastoris GS115 / pPICM#101 whose storage number wais CCTCC NO.M204071. It contained B and A strand synthesis, construction of express plasmid and engineering strain, transform of host cell, filter of transformant and over expression engineering strain, etc. The method left out the difficult procedure, reduced the process steps and shortened time, so the technique was simple. It overexpressed 10-100 folds than the others. It provided one new simple method for human insulin commercial process.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and it relates to the secretory expression of a human insulin gene, in particular to the expression of the human insulin gene in methanol yeast (Pichia Pastoris) GS115 / pPICM # 101. The secretory expression in the deposit number of CCTCC NO.M204071. Background technique [0002] Insulin is the only natural hormone secreted by B cells that lowers blood sugar. Its main function is to regulate the content of glucose in the blood and transport glucose to certain target cells in the body, and participate in the metabolism of the three major substances and energy in the body. Too high or too low blood sugar in the human body is a disease. No matter what the cause is, the decrease in insulin secretion, which is not needed for the regulation of blood sugar in the body, will cause the patient to develop insulin-dependent diabetes mellitus (IDDM). Insulin is necessary to treat these patients. Human in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/62C12N15/17C12N15/81C12P21/02
CPCC07K14/62C07K2319/50C12P21/02
Inventor 马延高马向东
Owner 马延高
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com