Human Source antibody for anti CD20 and epithelial cell adhesion molecule
A technology of antibodies and nucleic acid molecules, applied in the field of immunology, can solve problems such as the lack of CD20 and epithelial cell adhesion molecule antibodies
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Screening of variable region genes of anti-CD20 and anti-EpCAM antibodies from antibody libraries
[0064] The present invention utilizes phage antibody combinatorial library technology to recombine human antibody light chain genes and heavy chain genes in vitro, and uses phage display technology (phage display) system to screen specific antibody genes against target antigens. This technology bypasses the hybridoma pathway and can prepare and produce monoclonal antibodies that can be used to detect the expression of the target antigen without immunization. Methods as below:
[0065] Human antibody was constructed according to the method described in Chinese patent application 01126858.1 (application date: 2001.09.25; publication number: 1408874 publication date: 2003.04.09; invention title: construction of prokaryotic in vivo antibody library, antibody screening and optimization and use) library. Briefly, the genes for the heavy and light chains of immunoglobulins wer...
Embodiment 2
[0072] Recombinant expression of anti-CD20 single chain antibody
[0073] According to the antibody heavy chain and light chain sequences shown in SEQ ID NOs: 1 and 3, and the designed linking sequence for connecting the heavy chain and the light chain, the DNA fragments of the single-chain antibody (sequence such as: shown in SEQ ID NO: 9).
[0074] Use this DNA fragment as a template to carry out PCR reaction with the following primers,
[0075] Forward primer: CGG AAT TCC CAG GAG TCG GGC (SEQ ID NO: 11)
[0076] Reverse primer: CCGCTCGAGACGTTTGATTTCCACCTT (SEQ ID NO: 12)
[0077] After the PCR product was digested with EcoR I and Xho I, it was loaded into pGEX 5X-2 expression vector (purchased from Amersham Company) and transformed into E. coli. The single-chain antibody gene was expressed by the prokaryotic GST fusion system and affinity purified to obtain a soluble expression product with a purity of 90%, that is, the fusion protein of GST-single-chain antibody (GST-fu...
Embodiment 3
[0080] Recombinant expression of anti-EpCAM single chain antibody
[0081] According to the antibody heavy chain and light chain sequences shown in SEQ ID NOs: 5 and 7, and the designed linking sequence for connecting the heavy chain and the light chain, the DNA fragments of the single-chain antibody (sequence such as: shown in SEQ ID NO: 13).
[0082] Use this DNA fragment as a template to carry out PCR reaction with the following primers,
[0083] Forward primer: CGG AAT TCC GTG CAG TCT GGG CCT (SEQ ID NO: 15)
[0084] Reverse primer: CCGCTCGAGACGTTTGATTTCCAGCTTGG (SEQ ID NO: 16)
[0085] The PCR product was digested with EcoR I and Not I, and then loaded into pGEX 5X-2 expression vector (purchased from Amersham Company), and transformed into E. coli. The single-chain antibody gene was expressed by the prokaryotic GST fusion system and affinity purified to obtain a soluble expression product with a purity of 87%, that is, the fusion protein of GST-single-chain antibody (G...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 