Unlock instant, AI-driven research and patent intelligence for your innovation.

Human Source antibody for anti CD20 and epithelial cell adhesion molecule

A technology of antibodies and nucleic acid molecules, applied in the field of immunology, can solve problems such as the lack of CD20 and epithelial cell adhesion molecule antibodies

Inactive Publication Date: 2005-05-25
CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0015] At present, there is still a lack of effective antibodies against CD20 and epithelial cell adhesion molecule (EpCAM). Therefore, there is an urgent need in this field to develop new monoclonal antibodies with high specificity and neutralizing power against CD20 and EpCAM, especially humanized high affinity monoclonal antibody

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human Source antibody for anti CD20 and epithelial cell adhesion molecule
  • Human Source antibody for anti CD20 and epithelial cell adhesion molecule

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Screening of variable region genes of anti-CD20 and anti-EpCAM antibodies from antibody libraries

[0064] The present invention utilizes phage antibody combinatorial library technology to recombine human antibody light chain genes and heavy chain genes in vitro, and uses phage display technology (phage display) system to screen specific antibody genes against target antigens. This technology bypasses the hybridoma pathway and can prepare and produce monoclonal antibodies that can be used to detect the expression of the target antigen without immunization. Methods as below:

[0065] Human antibody was constructed according to the method described in Chinese patent application 01126858.1 (application date: 2001.09.25; publication number: 1408874 publication date: 2003.04.09; invention title: construction of prokaryotic in vivo antibody library, antibody screening and optimization and use) library. Briefly, the genes for the heavy and light chains of immunoglobulins wer...

Embodiment 2

[0072] Recombinant expression of anti-CD20 single chain antibody

[0073] According to the antibody heavy chain and light chain sequences shown in SEQ ID NOs: 1 and 3, and the designed linking sequence for connecting the heavy chain and the light chain, the DNA fragments of the single-chain antibody (sequence such as: shown in SEQ ID NO: 9).

[0074] Use this DNA fragment as a template to carry out PCR reaction with the following primers,

[0075] Forward primer: CGG AAT TCC CAG GAG TCG GGC (SEQ ID NO: 11)

[0076] Reverse primer: CCGCTCGAGACGTTTGATTTCCACCTT (SEQ ID NO: 12)

[0077] After the PCR product was digested with EcoR I and Xho I, it was loaded into pGEX 5X-2 expression vector (purchased from Amersham Company) and transformed into E. coli. The single-chain antibody gene was expressed by the prokaryotic GST fusion system and affinity purified to obtain a soluble expression product with a purity of 90%, that is, the fusion protein of GST-single-chain antibody (GST-fu...

Embodiment 3

[0080] Recombinant expression of anti-EpCAM single chain antibody

[0081] According to the antibody heavy chain and light chain sequences shown in SEQ ID NOs: 5 and 7, and the designed linking sequence for connecting the heavy chain and the light chain, the DNA fragments of the single-chain antibody (sequence such as: shown in SEQ ID NO: 13).

[0082] Use this DNA fragment as a template to carry out PCR reaction with the following primers,

[0083] Forward primer: CGG AAT TCC GTG CAG TCT GGG CCT (SEQ ID NO: 15)

[0084] Reverse primer: CCGCTCGAGACGTTTGATTTCCAGCTTGG (SEQ ID NO: 16)

[0085] The PCR product was digested with EcoR I and Not I, and then loaded into pGEX 5X-2 expression vector (purchased from Amersham Company), and transformed into E. coli. The single-chain antibody gene was expressed by the prokaryotic GST fusion system and affinity purified to obtain a soluble expression product with a purity of 87%, that is, the fusion protein of GST-single-chain antibody (G...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A humanized antibody to CD20 and epithelial cell adhesion molecule (EpCAM), and its preparing process and application are disclosed. Said antibody has high affinity and specificity to CD20 and EpCAM.

Description

technical field [0001] The invention belongs to the field of immunology, in particular to an anti-CD20 and anti-epithelial cell adhesion molecule (EpCAM) human antibody and a preparation method and application thereof. Background technique [0002] Antibodies have been used as agents for disease prevention, diagnosis and treatment for hundreds of years. The early method of preparing antibodies is to immunize animals with a certain natural antigen through various ways. After mature B cell clones are stimulated by the antigen, the antibodies are secreted into serum and body fluids. [0003] In fact, the antibody in serum is a mixture of multiple monoclonal antibodies, so it is called polyclonal antibody. Polyclonal antibodies are the first step in the purposeful use of antibodies in humans. The heterogeneity of polyclonal antibodies limits the further study and application of antibody structure and function. [0004] The birth of hybridoma technology is considered to be the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/395C07K16/18C12N15/12C12N15/63C12P21/08
Inventor 张新韩泽广
Owner CHINESE NAT HUMAN GENOME CENT AT SHANGHAI