Cecropin A-magainin hybrid gene engineering bactericidal peptide

Abstract

An eka-cecropinA-magainin heterozygous gene engineering antibacterial peptide is prepared by adopting No.1-7 amino acid residue on N end of cecropinA CA and No.2-12 amino acid residue on N end of magainin M, design synthesizing heterozygous peptide CA(1-7)-M(2-12) gene by codon, connecting with carrier pPICZ alpha-A, mutating by point mutation technology to obtain mutant pPICZ alpha-CA-Mu-1, pPICZ alpha-CA-Mu-2 and pPICZ alpha-CA-Mu-3, converting SMD1168, and expressing CecA-Mag heterozygous antibacterial peptide to make into use under alcohol hydrogenase starter regulation.

Description

A technical field

[0001] The invention discloses a cecropin A-maggainin hybrid genetically engineered antibacterial peptide, which belongs to the technical field of vaccine drug production by genetic engineering in the biotechnology pharmaceutical industry. Two background technology

[0002] Since the discovery of penicillin in 1929, antibiotics have played an important role in the prevention of bacterial infections and livestock and poultry diseases. In particular, the discovery of β-lactam antibiotics has revolutionized the treatment of pathogenic bacterial infectious diseases, and antibiotics have become clinical treatments. Many achievements of modern animal husbandry and veterinary medicine are based on the application of antibiotics. However, the long-term, extensive and indiscriminate use of antibiotics has not only led to serious problems of drug resistance of pathogens, but also caused hidden public health diseases such as drug residues. The emergence of many drug-...

Examples

Embodiment Construction

[0054] The preparation method of cecropin A-maggainin hybrid genetic engineering antimicrobial peptide comprises:

[0055] 1) Synthesis of cecropin A-Magnin (CecA-Mag) hybrid peptide parent gene

[0056] Select 1-7 amino acids of the mature peptide of cecropin A (CecA) with the accession number X06672 on Genbank and 2-12 amino acids of the mature peptide of Magaining (Mag) with the accession number J03193 on Genbank, and design two primer fragments For F1 and F2, use the F1 sequence and F2 sequence fragments as templates and primers for SOE PCR amplification to obtain a synthetic CecA-Mag hybrid peptide gene;

[0057] Primer F1, SEQ.ID.NO.1;

[0058] 5'CCTCTCGAGAAAAAGAAAGTGGAAGCTGTTCAAGAAGATCGGTCCAGGTAAG3'

[0059] Primer F2, SEQ.ID.NO.2;

[0060] 5'TAGTCTAGACTAGAACTTCTTGGCACTGTGCAGGAACTTACCTGGACCGATCTTCTT3'

[0061] PCR reaction system 50μl: 10×PCR Buffer, 5μL, MgCl 2 , 3 μL; dNTP, 1 μL; primer F1 and primer F2, 2 μL each; TaKaRaExTaqTM 0.5 μL; sterile ultrapure water, 3...

A technical field

[0001] The invention discloses a cecropin A-maggainin hybrid genetically engineered antibacterial peptide, which belongs to the technical field of vaccine drug production by genetic engineering in the biotechnology pharmaceutical industry. Two background technology

[0002] Since the discovery of penicillin in 1929, antibiotics have played an important role in the prevention of bacterial infections and livestock and poultry diseases. In particular, the discovery of β-lactam antibiotics has revolutionized the treatment of pathogenic bacterial infectious diseases, and antibiotics have become clinical treatments. Many achievements of modern animal husbandry and veterinary medicine are based on the application of antibiotics. However, the long-term, extensive and indiscriminate use of antibiotics has not only led to serious problems of drug resistance of pathogens, but also caused hidden public health diseases such as drug residues. The emergence of many drug-...

Examples

Embodiment Construction

[0054] The preparation method of cecropin A-maggainin hybrid genetic engineering antimicrobial peptide comprises:

[0055] 1) Synthesis of cecropin A-Magnin (CecA-Mag) hybrid peptide parent gene

[0056] Select 1-7 amino acids of the mature peptide of cecropin A (CecA) with the accession number X06672 on Genbank and 2-12 amino acids of the mature peptide of Magaining (Mag) with the accession number J03193 on Genbank, and design two primer fragments For F1 and F2, use the F1 sequence and F2 sequence fragments as templates and primers for SOE PCR amplification to obtain a synthetic CecA-Mag hybrid peptide gene;

[0057] Primer F1, SEQ.ID.NO.1;

[0058] 5'CCTCTCGAGAAAAAGAAAGTGGAAGCTGTTCAAGAAGATCGGTCCAGGTAAG3'

[0059] Primer F2, SEQ.ID.NO.2;

[0060] 5'TAGTCTAGACTAGAACTTCTTGGCACTGTGCAGGAACTTACCTGGACCGATCTTCTT3'

[0061] PCR reaction system 50μl: 10×PCR Buffer, 5μL, MgCl 2 , 3 μL; dNTP, 1 μL; primer F1 and primer F2, 2 μL each; TaKaRaExTaqTM 0.5 μL; sterile ultrapure water, 3...

Images