Clone, expression and application for lactic acid bacteria glutamic acid decarboxylase gene
A technology of glutamic acid decarboxylase and lactic acid bacteria, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of lack of safety, many by-products, toxicity or corrosion of chemical raw materials and solvents, and achieve the goal of not easily polluting miscellaneous The effect of bacteria
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0023] Example 1: Cloning of the Streptococcus salivarius subsp. thermophilus glutamic acid decarboxylase gene
[0024] Streptococcus thermophilus (Streptococcus thermophilus) (see reference: GABA colorimetric quantitative method research in the determination of glutamic acid decarboxylase activity, Food Science, 2006, 27: 205-209) into 100ml MRS medium, Incubate at 40°C for 12 hours. The bacteria were collected by centrifugation, and the genomic DNA of Streptococcus salivarius subsp.
[0025] Search for several bacterial glutamate decarboxylases from the NCBI website, perform bioinformatics analysis, and use the CODEHOP program (Timothy M.R., Emily R.S., Jorja G.H. et al. Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences.Nucleic Acids Res ., 1998, 26: 1628-1635.) designed two degenerate primers:
[0026]Primer 15'GGTACATCTACAATTGGTTCTTCTGARGCNTGYATG 3'
[0027] Primer 25' AAACCACCAGAAGCAGCRTCNACRTGNAT 3'
[0028] In a 100...
Embodiment 2
[0070] Embodiment 2: construction of prokaryotic expression vector of glutamic acid decarboxylase gene
[0071] According to the glutamic acid decarboxylase gene sequence obtained, design two primers, the upstream primer adds NcoI recognition sequence (in order to add NcoI recognition sequence CCATGG, in the glutamic acid decarboxylase gene initiation codon ATG and the second codon A codon GGC was inserted between AAT to allow NcoI to cut from this site, and the amino acid sequence of the recombinant glutamic acid decarboxylase correspondingly had one more glycine than the sequence of the natural enzyme), and the downstream primer plus EcoRI recognition sequence (underline part is the restriction enzyme recognition sequence):
[0072] Upstream primer 5'CGA CCATGG GCAATGAGAAGCTATTCAGAG 3’
[0073] Downstream primer 5'GAC GAATTC TTAATGATGGAAGCCACTGCG 3’
[0074] Add the components according to the following PCR system to amplify the glutamic acid decarboxylase gene:
[007...
Embodiment 3
[0084] Example 3: Expression of Streptococcus thermophilus glutamic acid decarboxylase in Escherichia coli
[0085] The expression plasmid pET-gad containing the gene of Streptococcus salivarius subsp. Then pick small colonies, insert into 50ml LB liquid medium containing ampicillin, cultivate overnight at 70-90rpm 30°C, take seed liquid according to the volume ratio of 1:40 and add it to 100ml LB liquid medium containing ampicillin, 35°C Shake at 180rpm for 2-3 hours until OD600 is about 0.6, add IPTG (final concentration 100μg / ml) to induce. After 1.5 hours, the cells were collected by centrifugation. Broken bacterium, extract glutamic acid decarboxylase according to the method described in " Enzyme Engineering " (Guo Yong editor-in-chief, China Light Industry Press, 2000), enzyme liquid is mixed with the material containing glutamic acid or glutamic acid salt (also It can directly use the bacteria to react with glutamic acid or glutamate solution without breaking the bact...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More