Unlock instant, AI-driven research and patent intelligence for your innovation.

Clone, expression and application for lactic acid bacteria glutamic acid decarboxylase gene

A technology of glutamic acid decarboxylase and lactic acid bacteria, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of lack of safety, unsuitable for food additives and medicine, severe chemical synthesis reaction conditions, etc. effect of bacteria

Inactive Publication Date: 2007-10-31
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to severe chemical synthesis reaction conditions, toxic or corrosive chemical raw materials and solvents, many by-products, and lack of safety, it is mainly used in the chemical industry and is not suitable for food additives and medicines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Cloning of the Streptococcus salivarius subsp. thermophilus glutamic acid decarboxylase gene

[0024] Inject Streptococcus thermophilus (Streptococcus thermophilus) (see reference: GABA colorimetric quantitative method research in the determination of glutamic acid decarboxylase activity, Food Science, 2006, 27: 205-209) into 100ml MRS medium, Incubate at 40°C for 12 hours. The bacteria were collected by centrifugation, and the genomic DNA of Streptococcus salivarius subsp.

[0025] Search for several bacterial glutamate decarboxylases from the NCBI website, perform bioinformatics analysis, and use the CODEHOP program (Timothy M.R., Emily R.S., Jorja G.H. et al. Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences.Nucleic Acids Res ., 1998, 26: 1628-1635.) designed two degenerate primers:

[0026] Primer 15'GGTACATCTACAATTGGTTCTTCTGARGCNTGYATG 3'

[0027] Primer 25' AAACCACCAGAAGCAGCRTCNACRTGNAT 3'

[0028] In...

Embodiment 2

[0070] Embodiment 2: construction of prokaryotic expression vector of glutamic acid decarboxylase gene

[0071] According to the glutamic acid decarboxylase gene sequence obtained, design two primers, the upstream primer adds NcoI recognition sequence (in order to add NcoI recognition sequence CCATGG, in the glutamic acid decarboxylase gene initiation codon ATG and the second codon A codon GGC was inserted between AAT to allow NcoI to cut from this site, and the amino acid sequence of the recombinant glutamic acid decarboxylase correspondingly had one more glycine than the sequence of the natural enzyme), and the downstream primer plus EcoRI recognition sequence (underline part is the restriction enzyme recognition sequence):

[0072] Upstream primer 5'CGA CCATGGG CAATGAGAAGCTATTCAGAG 3’

[0073] Downstream primer 5'GAC GAATTC TTAATGATGGAAGCCACTGCG 3’

[0074] Add the components according to the following PCR system to amplify the glutamic acid decarboxylase gene:

[007...

Embodiment 3

[0084] Example 3: Expression of Streptococcus thermophilus glutamic acid decarboxylase in Escherichia coli

[0085] The expression plasmid pET-gad containing the gene of Streptococcus salivarius subsp. Then pick small colonies, insert into 50ml LB liquid medium containing ampicillin, cultivate overnight at 70-90rpm 30°C, take seed liquid according to the volume ratio of 1:40 and add it to 100ml LB liquid medium containing ampicillin, 35°C Shake at 180rpm for 2-3 hours until OD600 is about 0.6, add IPTG (final concentration 100μg / ml) to induce. After 1.5 hours, the cells were collected by centrifugation. Broken bacterium, extract glutamic acid decarboxylase according to the method described in " Enzyme Engineering " (Guo Yong editor-in-chief, China Light Industry Press, 2000), enzyme liquid is mixed with the material containing glutamic acid or glutamic acid salt (also It can directly use the bacteria to react with glutamic acid or glutamate solution without breaking the bact...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a colony, expression and appliance of lactic acid bacteria aminoglutaric acid decarboxylase gene in food industry biotechnics domain, which is characterized by the following: coming from spittle streptococcus thermophilic subspecies (Streptococcus thermophilus) with length at 1380bp; augmenting from gene group DNA through PCR; adding NcoI and EcoRI on the two ends of the gene; limiting enzyme identification sequence; connecting to pET-DsbA of same limited enzyme alimentary; transforming expressing host bacteria BL21(DE3)pLysS of bacillus coli; realizing retooling expression in bacillus coli; getting glutamic acid decarboxylase molecule with molecular weight at 52. 4kDa; transforming L- glutamic acid decarboxylase to gamma-aminobutyric acid with retooling enzyme; providing a great amount of and high active rough enzyme for enzymatical synthesis of gamma-aminobutyric acid; decreasing cost of enzymatical synthesis of gamma-aminobutyric acid. This method possesses warm condition, which belongs to biological synthesis method.

Description

1. Technical field [0001] The invention relates to the cloning, expression and application of a lactic acid bacteria glutamic acid decarboxylase gene, which belongs to the field of food industry biotechnology. 2. Background technology [0002] γ-Aminobutyric acid (γ-Aminobutyric acid, GABA), also known as aminobutyric acid, is a natural amino acid composed of non-protein, which is a major inhibitory neurotransmitter in the mammalian central nervous system and has important physiological functions , such as lowering blood pressure, diuresis, analgesia, improving brain function, enhancing brain vitality, promoting long-term memory, nourishing nerve cells, improving menopausal syndrome, etc. Long-term lack of GABA in the brain will lead to epilepsy, Parkinson and other diseases. At the same time, GABA is also related to brain aging, and its deficiency will lead to "deafness and blindness" in the elderly. In addition, GABA can promote the ability of sperm to penetrate eggs, im...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/60C12N9/88C12P13/00
Inventor 陆兆新林谦吕凤霞别小妹焦阳王煜邹晓葵
Owner NANJING AGRICULTURAL UNIVERSITY