Method for quantitative analyzing evolution of RNA structure steadiness
A technology for RNA structure and quantitative analysis, applied in the field of computer programs, can solve problems such as difficult quantification and robustness evolution evaluation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0023] figure 1 It is an overall block diagram of a method for quantitatively analyzing the evolution of RNA structural robustness in the present invention.
[0024] For the RNA sequence input from the computer terminal, the legality check is performed according to the definition of the RNA sequence. The RNA sequence is taken from the alphabet A string R=r for 1 , r 2 ,...,r n ,in i=1, 2, . . . , n. For input sequences that do not conform to this definition, return to re-input. Adopt the present invention, the example of analysis is the sequence of the microRNA let-7 precursor that length is 1=99 in the nematode:
[0025] UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGU
[0026] GAACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA
[0027] After checking the legitimacy of the RNA sequence input from the computer terminal, along the Hamming distance of the input RNA sequence, select a completely random scrambling method among the five scrambling methods, and use the M...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
