Method for quantitative analyzing evolution of RNA structure steadiness

A technology for RNA structure and quantitative analysis, applied in the field of computer programs, can solve problems such as difficult quantification and robustness evolution evaluation

Inactive Publication Date: 2008-10-08
INST OF RADIATION MEDICINE ACAD OF MILITARY MEDICAL SCI OF THE PLA
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention aims to provide a quantitative analysis method that can simply, conveniently and quickly measure the evolution of RNA structural robustness, solve the problems of difficult evolution evaluation and quantification of robustness, and achieve the goal of analyzing the origin and evolution of biological robustness purpose, thereby improving the understanding of biological evolution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quantitative analyzing evolution of RNA structure steadiness
  • Method for quantitative analyzing evolution of RNA structure steadiness
  • Method for quantitative analyzing evolution of RNA structure steadiness

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] figure 1 It is an overall block diagram of a method for quantitatively analyzing the evolution of RNA structural robustness in the present invention.

[0024] For the RNA sequence input from the computer terminal, the legality check is performed according to the definition of the RNA sequence. The RNA sequence is taken from the alphabet A string R=r for 1 , r 2 ,...,r n ,in i=1, 2, . . . , n. For input sequences that do not conform to this definition, return to re-input. Adopt the present invention, the example of analysis is the sequence of the microRNA let-7 precursor that length is 1=99 in the nematode:

[0025] UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGU

[0026] GAACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA

[0027] After checking the legitimacy of the RNA sequence input from the computer terminal, along the Hamming distance of the input RNA sequence, select a completely random scrambling method among the five scrambling methods, and use the M...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a computer program, more specifically to a method for quantitatively analyzing the evolution of RNA structural robustness. The invention aims to provide a quantitative analytical method capable of analyzing RNA structural robustness simply, conveniently and quickly, solves the problem that RNA structural robustness is difficult to evaluate and quantify, reaches the objective of analysis of biological robustness origin and evolution thereof, thus improving the understanding of biological evolution. The invention is based on a RNA secondary structure as the research platform, provides a method for quantitatively analyzing the evolution of RNA structural robustness. The method comprises the steps of checking the validity of a RNA sequence inputted from a computer terminal, generating a control sequence, calculating RNA structural robustness, and quantitatively analyzing the evolution of the RNA structural robustness.

Description

technical field [0001] The present invention relates to a computer program, and more particularly, to a method for the quantitative analysis of the evolution of the robustness of RNA structures. Background technique [0002] Biological robustness is one of the most basic and ubiquitous phenomena in biological systems. It is understood as the ability to maintain a stable function in the face of various disturbances. Depending on the nature of the disturbance (heritable or not), robustness can be divided into genetic robustness and environmental robustness. Genetic robustness refers to the insensitivity of phenotype in the face of genetic mutation interference; while environmental robustness refers to the insensitivity of phenotype in the face of interference from external environmental factors. For a long time, biologists have paid great attention to the study of biological robustness, from Fisher's dominant study to Waddington's developmental homeostasis study. Research h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G06F19/00G16B10/00
Inventor王升启舒文杰伯晓晨
OwnerINST OF RADIATION MEDICINE ACAD OF MILITARY MEDICAL SCI OF THE PLA