Use of ShRNA in preparing medicament for improving survival ratio of xenogenic organ transplantation
A technology of allogeneic transplantation and survival rate, which is applied in the field of molecular immunity, can solve the problems of nephrotoxicity, achieve strong nephrotoxicity, strong ability to inhibit organ transplant rejection, and prolong survival time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] The application of small molecular interfering RNA in the preparation of medicines for prolonging the survival rate of allogeneic organ transplantation, the steps are:
[0032] 1. Selection of target sequence: According to the gene sequence of Corel beta 1,3-galactosyltransferase (AF157962) provided by GeneBank, its homology and RNA secondary structure were analyzed by BLAST and RNA structure3.5 respectively, and a 21nt core was selected. The nucleotide sequence 5'-GCGAAGATTTAAGCCCTATGT-3' is used as the target sequence (a construction method and application of an shRNA expression vector that inhibits corel β1-3 galactosyltransferase. In 2006, Wuhan University applied for a Chinese invention patent, and the application patent number was 200610019901.0 , the inventors are Zhang Xiaolian, Zhou Xia).
[0033] 2. Design and synthesize primers. The primer sequences are: Oligo1.5'GCGAAGATTTAAGCCCTATGTTTCA 3'; Oligo2.5'AGCTTGAAACATAGGGCTTAAATCTTCGCGGCC 3'; Oligo3.5'AGCTTACATA...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap