Unlock instant, AI-driven research and patent intelligence for your innovation.

Maize gene Opaque1 molecular marker and application thereof

A technology of molecular markers and genes, which is applied in the fields of application, plant genetic improvement, microbial measurement/inspection, etc., can solve the problems of not obtaining co-dominant DNA molecular markers, inability to assist selection, etc., and achieve high accuracy and simple operation Effect

Inactive Publication Date: 2011-11-23
SHANGHAI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in previous studies, no co-dominant DNA molecular markers closely linked to the O1 gene located on both sides of the chromosome physical position were obtained, so it was impossible to perform DNA molecular marker-assisted selection on the target traits controlled by this gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Maize gene Opaque1 molecular marker and application thereof
  • Maize gene Opaque1 molecular marker and application thereof
  • Maize gene Opaque1 molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Acquisition of two co-dominant molecular markers and determination of linkage relationship with O1

[0032] F1 (O1 / +) was obtained by crossing the homozygous mutant (O1 / O1) with the homozygous wild type (+ / +), and then the F1 was used as the female parent, and the homozygous mutant was used as the male parent for backcrossing to construct a backcross ( BC) groups, see image 3 . Genotype segregation appeared in the BC population, including two genotypes of O1 / + and O1 / O1, and the grains with O1 / + genotype and + / + genotype were all non-Opaque wild type, with O1 / O1 The kernel of the genotype is the mutant type of Opaque, see figure 1 and figure 2 .

[0033] Take 1000 seeds of Opaque and non-Opaque types in the BC population, as well as the seeds of homozygous mutants and homozygous wild-type parents, and put the two parents, Opaque and non-Opaque seeds in petri dishes filled with tap water at room temperature (22-25°C) After soaking for 7 hours, the seeds...

Embodiment 2

[0050] Example 2: Polymorphism identification of molecular markers among different parents

[0051] The method in Example 1 was used to extract the genomic DNA of O1, wild type and four widely used inbred lines B73, Mo17, W64A and BSSS53, and identify polymorphisms among different varieties by PCR reaction. The results showed that the molecular marker IDPg21 in the present invention can distinguish O1 from five inbred lines B73, Mo17, W64A, W22 and BSSS53, and IDPg25 can distinguish O1 from four inbred lines B73, Mo17, W64A and W22. When four inbred lines B73, Mo17, W64A and W22 were used as the background to introduce the O1 gene for high-quality protein maize breeding, the molecular markers IDPg21 and IDPg25 can play the role of assisted selection for the O1 gene, see Figure 7 and Figure 8 .

Embodiment 3

[0052] Example 3: The method of molecular marker-assisted selection of O1 gene by IDPg21 and IDPg25

[0053] Using these two co-dominant molecular markers IDPg21 and IDPg25, the genotype of O1 can be identified. Molecular markers IDPg21 and IDPg25 were used to analyze the offspring in a certain cross combination, and the genotype of the plants with the same wild-type (such as B73, Mo17, W64A and W22) bands on both sides was the wild type, and the molecular markers on both sides The genotype of plants whose markers are both heterozygous (such as F1) type bands is heterozygous, and the genotype of plants whose molecular markers on both sides are both O1 / O1 pure and mutant type bands is mutants. Using these two molecular markers, the accuracy of genotype identification for each individual plant of the offspring during cross breeding is very high, and the probability of misselection is only 1.89×10 -5 , so these two molecular markers play an important auxiliary role in molecular ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a maize gene Opaque1 molecular marker and the application thereof. The specific primer and the base sequence of the augmented DNA fragment IDPg 21 of the molecular marker is that a forward primer is GGGCTTATCTCGCTCTCCA from 5'end to 3'end, and a reverse primer is GGTGCCGGGCATAGTCTAA from 5'end to 3'end; and the specific primer and the base sequence of the augmented DNA fragment IDPg 25 is that the forward primer is CGCTTATTGATGAGCAGTCTG from 5'end to 3'end, and the reverse primer is GGATACTATACTCGATCGCAAT. By utilizing the two molecular markers of the invention, the DNA type of any tissue of maize in any period can be identified, and the existence of 01 gene in each single plant of hybridization breeding offspring and the state of heterozygosis or homozygosis are detected. The detection method has high accuracy, is easy to operate, and provides an important technological measure for the DNA molecular marker assistant breeding utilizing the 01 gene.

Description

technical field [0001] The invention relates to a molecular marker of maize gene and its application, in particular to a molecular marker of maize gene Opaque1 and its application. technical background [0002] Cereal crops provide about 50% of human protein intake and 70% in developing countries (Gibbon and Larkins, 2005). With the continuous growth of the world population and the continuous adjustment of the diet structure of developing countries, more food needs to be produced on the world's limited arable land. Therefore, the food problem has become increasingly prominent and urgently needs to be resolved. [0003] Maize (Zea mays L.) is one of the most widely distributed crops in the world, and its cultivated area ranks third in the world after wheat and rice. It is the main food and feed crop in the world and also in our country. According to FAO statistics, since 1998, the total output of corn has surpassed that of wheat and rice to become the world's largest food ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11A01H1/04
Inventor 宋任涛王桂凤林佃彬王慧张晶许政暟
Owner SHANGHAI UNIV