Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting SNP locus of gene associated with individualized medication of warfarin and PCR amplification method thereof

A kit and gene technology, applied in the field of kits for detection of SNP sites of genes related to warfarin individualized medication and its PCR amplification, can solve the problems of low specificity, high price, low efficiency, etc. Achieve high specificity, save capital, and improve experimental efficiency

Active Publication Date: 2010-12-01
SUZHOU KUANGYUAN MOLECULAR BIOTECH
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The invention provides a mononuclear test for detecting vitamin K epoxide reductase complex 1 gene VKORC1 (-1639G / A) and cytochrome P450 enzyme 2C9 gene CYP2C9 (1075A / C), which affect clinical warfarin individualized dosage. A kit for nucleotide polymorphism (SNP) and a PCR amplification method thereof, the purpose is to solve the problem of high price, high cost and Low efficiency, low throughput and low specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting SNP locus of gene associated with individualized medication of warfarin and PCR amplification method thereof
  • Kit for detecting SNP locus of gene associated with individualized medication of warfarin and PCR amplification method thereof
  • Kit for detecting SNP locus of gene associated with individualized medication of warfarin and PCR amplification method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1: A kit for detecting single nucleotide polymorphism sites in genes associated with warfarin individualized medication comprising: 10×PCR Buffer, dNTP (2.5mM), Pfu DNA polymerase (2.5U / μl) and primers (10 mM each).

[0048] The base sequence of the primers for detecting the SNP site of the gene VKORC1 (-1639G / A) is as follows:

[0049] Forward primer: CCTGAAAAACAACCATTGGTCG (VKORC1-1639Gss);

[0050] CCTGAAAAACAACCATTGGTCA (VKORC1-1639Ass);

[0051] Reverse primer: AGTTTGGACTACAGGTGCCTG (VKORC1-1639R).

[0052] The base sequence of the primers for detecting the SNP site of gene CYP2C9(1075A / C) is as follows (5'→3'):

[0053] Forward primer: TGCACGAGGTCCAGAGATACAT (CYP2C9 1075Ass);

[0054] TGCACGAGGTCCAGAGATACCT (CYP2C9 1075Css);

[0055] Reverse primer: ACTGGAAACAAGAGAAAGTCCA (CYP2C9 1075R).

[0056] The -1, -2, -3 bases at the 3' end of the four forward primers were modified by phosphorothioation.

Embodiment 2

[0057] Example 2: A PCR amplification method used in a kit for detecting single nucleotide polymorphism sites of warfarin individualized drug-related genes

[0058] Include the following steps:

[0059] Step 1: Prepare DNA

[0060] (1) A blood sample is drawn from patient A.

[0061] (2) To obtain DNA from blood samples, we used the UNIQ-10 kit produced by Shanghai Bioengineering Technology Co., Ltd. for extraction.

[0062] Procedure for obtaining DNA from patient A's blood sample:

[0063] a. Take 500ul of blood samples that have been added with ACD (0.48% Citric Acid (citric acid); 1.32% Sodium Citrate (sodium citrate); 1.47% Glucose (glucose)) anticoagulant.

[0064] b. Add 1ml sterile water to 500ul blood sample, centrifuge at 5000 rpm for two minutes to remove the supernatant, and suspend the white blood cells with 200ulTE.

[0065] c. Add 200ul Digestion Buffer to the 200ul sample prepared in step b and mix well, then add 20ul Proteinase K (10mg / ml), mix well, and s...

Embodiment 3

[0087] Example 3: A PCR amplification method used in a kit for detecting single nucleotide polymorphism sites of warfarin individualized drug-related genes

[0088] A blood sample was drawn from Patient B. Other experimental conditions are the same as in Example 2.

[0089] The result is: the gel electrophoresis obtained by using the primers to detect the SNP site of the gene VKORC1 (-1639G / A) is as attached figure 1 As shown in the middle of , there are products in both Ass and Gss lanes, indicating that the patient is heterozygous for the VKORC1(-1639A / G) mutation, and the patient is more sensitive to warfarin. The patient should appropriately reduce the dose of warfarin. The results can be attached by DNA sequencing image 3 Confirmed (sequencing with reverse primer).

[0090] The gel electrophoresis obtained by using primers to detect the SNP site of the gene CYP2C9 (1075A / C) is shown in the attached Figure 5 As shown in the middle of , there is only product in the As...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting SNP locus of a gene associated with individualized medication of warfarin and a PCR amplification method thereof. The kit comprises two forward primers and a reverse primer used for detecting SNP locus of a gene VKORC1(-1639G / A) and / or two forward primers and a reverse primer used for detecting SNP locus of a gene CYP2C9(1075A / C). The kit of the invention can realize the high-efficiency and high-pass detection of the SNP loci of VKORC1(-1639G / A) and CYP2C9(1075A / C), so that the quantized control on the amount of warfarin is achieved; furthermore, the method plays a certain role in prevention of thrombotic diseases, choice of anticoagulants, research and development of new anticoagulants and prognosis of thrombotic diseases.

Description

technical field [0001] The present invention relates to a kit for detecting SNP sites of genes related to warfarin individualized medication and a PCR amplification method thereof, in particular to a vitamin K epoxide reductase compound for detecting clinical warfarin medication doses The kit and the PCR amplification method of single nucleotide polymorphism (SNP) of object 1 gene VKORC1 (-1639G / A) and cytochrome P450 enzyme 2C9 gene CYP2C9 (1075A / C) belong to the clinical practice in the field of biomedicine Detection Technology. Background technique [0002] Warfarin is a dicoumarin derivative oral anticoagulant widely used clinically. It produces an anticoagulant effect by interfering with the conversion cycle between epoxidized vitamin K and hydroquinone vitamin K. It is mainly used for the prevention and treatment of thrombotic diseases such as thromboembolic phlebitis, pulmonary infarction, atrial fibrillation, etc. It is also necessary to routinely take warfarin afte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 秦正红王进缪丽燕刘二平
Owner SUZHOU KUANGYUAN MOLECULAR BIOTECH