Unlock instant, AI-driven research and patent intelligence for your innovation.

PCR primer pair, kit and method for identifying true cordyceps sinensis and false cordyceps sinensis

A technology of Cordyceps sinensis and primer pairs, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as high price, scarce resources, and difficulty in wild Cordyceps sinensis, and achieve accurate identification and good application. Foreground effect

Inactive Publication Date: 2011-10-26
张雪峰
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Due to the special requirements of growing geography and strict parasitic nature, Cordyceps sinensis resources are extremely scarce, and the difficulty of harvesting makes wild Cordyceps sinensis very precious and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR primer pair, kit and method for identifying true cordyceps sinensis and false cordyceps sinensis
  • PCR primer pair, kit and method for identifying true cordyceps sinensis and false cordyceps sinensis
  • PCR primer pair, kit and method for identifying true cordyceps sinensis and false cordyceps sinensis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Design and synthesis of detection PCR primers and testing of samples

[0025] 1. Design PCR amplification primers

[0026] The primers were designed according to the Cordyceps sinensis 18s ribosomal gene sequence information publicly registered on GenBank (design primers

[0027] See the part of figure 1 ).

[0028] The sequence information is GenBank: HM135169 (total 1741bp), (Cordyceps sinensis, 18S ribosomal RNA, http: / / www.ncbi.nlm.nih.gov / nuccore / HM135169).

[0029] The upstream primer was designed at 446-466 and named: CC18s-F. The sequence is: 5'CAATAAATACCGATACAGGGC 3'(SEQ ID No.1);

[0030] The downstream primers were designed at 1179-1198 and named: CC18s-R. The sequence is: 5'TGTCTGGACCTGGTGAGTTT 3' (SEQ ID No.2).

[0031] The amplified target sequence is shown in SEQ ID No.3 (446-1198). The region of 579 bases in the middle is preferably the credible interval (see figure 1 underlined part)

[0032] 2. Extract Cordyceps DNA

[0033] Cordyc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of medicinal material identification, more specifically to indentify true cordyceps sinensis and false cordyceps sinensis. A specific and reliable method of the present invention for detecting and identifying cordyceps sinensis is provided to solve technical problems. The present invention provides a PCR primer pair, a kit and a method for identifying true cordyceps sinensis and false cordyceps sinensis so as to solve technical problems. The sequence of the primer pair are: an upstream primer denotes 5<,>CAATAAATACCGATACAGGGC 3<,>; a downstream primer denotes 5<,>TGTC TGGACCTGGTGAGTTT 3<,>. According to the invention, target fragments of cordyceps sinensis and the common counterfeits can be effectively amplified by the primer pair, and can be accurately identified, thereby, the invention has good application prospects.

Description

technical field [0001] The invention belongs to the field of medicinal material identification, and in particular relates to a pair of PCR primers, a kit and a method for identifying the authenticity of Cordyceps sinensis. Background technique [0002] Cordyceps sinensis (Berkeley) Saccardo is an entomoascus fungus formed by parasitizing on the larvae of the genus Hepialus (Hepialus) of the ergotaceae fungus Cordyceps sinensis. The host is a composite of the larvae of the bat moth, an insect of the family Lepidoptera, which is mainly distributed in the Qinghai-Tibet Plateau. It is used for chronic cough, shortness of breath, hemoptysis due to fatigue, impotence and nocturnal emission, soreness of the waist and knees. It is a traditional Chinese medicinal material in my country. [0003] Due to the special pharmacological and therapeutic effects of Cordyceps sinensis, many counterfeit products similar in shape to Cordyceps sinensis appear in the market, among which Cordyceps h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
Inventor 张雪峰徐丽
Owner 张雪峰