Supercharge Your Innovation With Domain-Expert AI Agents!

RT-LMAP (reverse transcription loop-mediated isothermal amplification) agent for detecting Arabis mosaic virus as well as preparation method and application thereof

A technology of RT-LAMP and detection reagents, which is applied in the field of biological preparations for the detection of Arabidopsis mosaic virus, can solve the problems of cross-contamination false positive results, long detection time period, and high detection cost, and achieve short detection time and short detection cycle , low cost effect

Inactive Publication Date: 2011-11-02
NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The RT-PCR method, such as the invention patent application with the publication number CN101307365, is a technology for detecting the viral nucleic acid of Arabidopsis thaliana mosaic virus, which has good sensitivity and specificity, but it needs PCR post-processing such as DNA electrophoresis, and the operation is complicated. The detection cost is high, the detection time period is long, it takes 6-8 hours, and it is also exposed to the toxic reagent ethidium bromide, which is prone to cross-contamination and cause false positive results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RT-LMAP (reverse transcription loop-mediated isothermal amplification) agent for detecting Arabis mosaic virus as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] Below in conjunction with embodiment the present invention is described in further detail.

[0032] 1. Design primers

[0033] The present invention selects the conserved fragment of the ArMV coat protein coding gene as the target, carries out homology analysis and comparison through the CP coding gene sequences of the ArMV strains reported in GenBank, selects the conserved fragment (226bp) of the ArMV characteristic gene, and uses the primer Express3.0 software, design primers (including said FIP, BIP, F3, B3, Loop1, Loop2 three pairs of primers). The primers were synthesized by conventional β-acetonitrile phosphorous acid amine chemical synthesis method. After optimizing the reaction time and temperature of multiple pairs of primers designed and synthesized, determine the reaction conditions with the best amplification efficiency and specificity.

[0034] 2. RNA extraction

[0035] Take 100 μL volume of ground homogenate sample supernatant, add 700 μL Trizol reagen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses an RT-LMAP (reverse transcription loop-mediated isothermal amplification) agent for detecting Arabis mosaic virus as well as a preparation method and an application thereof. The agent is well-designed and synthesized by selecting a CP coding gene fragment as a target sequence, which is specific to Arabis mosaic virus and relatively conserved among individual strains. The agent comprises three pairs of specific primers and has a target fragment length of 226 bp; and the sequences of the primers are as follows: ccccgttccattcactaacaactcttttattggtggtatggtcaaggg, and actggaatcaactgtttaaataccccgtttttagggggagcgaatttcaat; taatacactcttgagttactatctagg, and taagcgcagtggagttcgat; and tgccataagtgcaagggct, and tgttacatcgaggaggatgg. The invention overcomes the problems that the conventional RT-PCR method takes a long period of time, needs expensive equipment and requires electrophoresis after amplification, achieves the purpose of rapid, accurate and qualitative detection of ArMV (Arabis mosaic virus) in samples, and has the advantages of low cost, simplicity and easiness in operation, visual detection result, high sensitivity, good reproducibility and the like.

Description

technical field [0001] The invention relates to a biological agent for detecting Arabidopsis mosaic virus, in particular to a reagent for detecting Arabidopsis mosaic virus RT-LAMP, a preparation method and an application. Background technique [0002] Arabis mosaic virus (ArMV) belongs to the genus Nepovirus of the family Comoviridae, and its virions are equidiameter polyhedral spheres with a diameter of about 30nm. ArMV is a virus that spreads easily. It has a wide range of hosts and can infect about 174 genera and 215 species of plants, harming various economic crops such as vegetables, flowers, and trees. Cucumber is dwarfed and mottled, lettuce is chlorotic and dwarfed, celery is dwarfed and necrotic, forsythia yellow fruit and other symptoms. A. thaliana mosaic virus can be transmitted by seeds, sap, grafting, machinery, dodder and vector nematodes. At present, the virus is mainly distributed in Europe, America, Oceania and Japan in Asia, and is a quarantine pest ann...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/94
Inventor 闻伟刚王建峰崔俊霞张吉红杨文潮
Owner NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More