RT-LMAP (reverse transcription loop-mediated isothermal amplification) agent for detecting Arabis mosaic virus as well as preparation method and application thereof

Abstract

The invention discloses an RT-LMAP (reverse transcription loop-mediated isothermal amplification) agent for detecting Arabis mosaic virus as well as a preparation method and an application thereof. The agent is well-designed and synthesized by selecting a CP coding gene fragment as a target sequence, which is specific to Arabis mosaic virus and relatively conserved among individual strains. The agent comprises three pairs of specific primers and has a target fragment length of 226 bp; and the sequences of the primers are as follows: ccccgttccattcactaacaactcttttattggtggtatggtcaaggg, and actggaatcaactgtttaaataccccgtttttagggggagcgaatttcaat; taatacactcttgagttactatctagg, and taagcgcagtggagttcgat; and tgccataagtgcaagggct, and tgttacatcgaggaggatgg. The invention overcomes the problems that the conventional RT-PCR method takes a long period of time, needs expensive equipment and requires electrophoresis after amplification, achieves the purpose of rapid, accurate and qualitative detection of ArMV (Arabis mosaic virus) in samples, and has the advantages of low cost, simplicity and easiness in operation, visual detection result, high sensitivity, good reproducibility and the like.

Description

technical field [0001] The invention relates to a biological agent for detecting Arabidopsis mosaic virus, in particular to a reagent for detecting Arabidopsis mosaic virus RT-LAMP, a preparation method and an application. Background technique [0002] Arabis mosaic virus (ArMV) belongs to the genus Nepovirus of the family Comoviridae, and its virions are equidiameter polyhedral spheres with a diameter of about 30nm. ArMV is a virus that spreads easily. It has a wide range of hosts and can infect about 174 genera and 215 species of plants, harming various economic crops such as vegetables, flowers, and trees. Cucumber is dwarfed and mottled, lettuce is chlorotic and dwarfed, celery is dwarfed and necrotic, forsythia yellow fruit and other symptoms. A. thaliana mosaic virus can be transmitted by seeds, sap, grafting, machinery, dodder and vector nematodes. At present, the virus is mainly distributed in Europe, America, Oceania and Japan in Asia, and is a quarantine pest ann...

AI Technical Summary

Problems solved by technology

The RT-PCR method, such as the invention patent application with the publication number CN101307365, is a technology for detecting the viral nucleic acid of Arabidopsis thaliana mosaic virus, which has good sensitivity and specificity, but it needs PCR post-processing such as DNA electrophoresis, and the operation is complicated. The detection cost is high, the detection time period is long, it takes 6-8 hours, and it is also exposed to the toxic reagent ethidium bromide, which is prone to cross-contamination and cause false positive results

Images