Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

115 results about "Reverse Transcription Loop-mediated Isothermal Amplification" patented technology

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) is a technique for the amplification of RNA. Within the last 10 years of its development, applications of the LAMP method in pathogenic microorganisms, genetically modified ingredients, tumor detection, and embryo sex identification have been widely used. This method was then improved by taking it a step further and combining it with a reverse transcription phase to allow for the detection of RNA. RT-LAMP is a one step nucleic acid amplification method that is used to diagnose infectious disease caused by bacteria or viruses. Although it has not been formally recognised by NAT, the method has been developed into many commercial kits that can be used for the identification of pathogens. The commonly used PCR method is able to generate millions of copies of the target strand. This process relies on thermal cycling, cycles of heating and cooling to facilitate the DNA replication. RT-LAMP does not require these cycles and is performed at a constant temperature between 60 and 65 °C. Similar to RT-PCR, RT-LAMP uses reverse transcriptase to synthesize complementary DNA (cDNA) from RNA sequences. This cDNA is then amplified using DNA polymerase, generating 10^9 copies per hour.

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay kit and detection method for grass carp reoviruses

The invention discloses a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay kit and a detection method for grass carp reoviruses (GCRV), and belongs to the technical field of the detection of fish viruses. The RT-LAMP assay kit for the grass carp reoviruses comprises the following ingredients: 1*ThermoPol Reaction Buffer, Bacillus stearothermophilus deoxyribonucleic acid (BstDNA) polymerase, deoxyribonucleotide triphosphate (dNTPs), AMV reverse transcriptase, outer primers (F3 and B3), inner primers (FIP and BIP), Betaine, MgCl2, dithiothreitol (DTT) and 1,000*SYBR Green I. The assay kit has the characteristics of simpleness, convenience, quickness and high specificity and sensitivity; GCRV-104 in a sample can be accurately detected within 2 hours only by using a water bath kettle or metal bath; and the assay kit can detect grass carp tissues infected by the GCRV-104 and cells (such as cytokine-induced killer (CIK) cells) infected by the GCRV-104, and is applicable to the on-site rapid detection of the GCRV-104.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

RT-LAMP assay for the detection of pan-serotype dengue virus

InactiveUS20110306036A1Rapid and inexpensive detectionRapid and inexpensive and diagnosisMicrobiological testing/measurement4 serotypeSerotype
The invention relates to a reverse transcription loop-mediated isothermal amplification (LAMP) assay for the detection of dengue virus. The assay is capable of simultaneous detection of dengue 1-4 serotypes in a single reaction.
Owner:THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE NAVY

Methods for real-time multiplex isothermal detection and identification of bacterial, viral, and protozoan nucleic acids

Herein disclosed are rapid real-time isothermal multiplex methods of detecting, identifying and quantifying bacterial, viral, and protozoan nucleic acids in a sample. These include contacting the sample with two or more sets of pathogen-specific reverse transcription loop-mediated isothermal amplification primers and novel oligofluorophores specific for the target bacterial, viral, and parasitic nucleic acids of interest such as human immunodeficiency virus, Ebola virus, Marburg virus, Yellow fever virus, hepatitis-B virus, Lassa fever virus, Plasmodium, hepatitis-C virus, hepatitis-E virus, dengue virus, Chikungunya virus, Japanese Encephalitis virus, Middle Eastern Respiratory Syndrome Corona virus, Mycobacterium, West Nile virus, Cytomegalovirus, Parvovirus, Leishmania, Trypanosoma, and Zika virus nucleic acids, under conditions sufficient to produce detectable real-time amplification signals in about 10 to 40 minutes. The amplification signals are produced by pathogen-specific fluorogenic labels included in one or more of the primers. Also, novel reaction and sample lysis buffers, primers, and kits for rapid multiplex detection, quantification, and identification of bacterial, viral, and protozoan nucleic acids by real-time isothermal amplification are herein disclosed.
Owner:NYAN DOUGBEH CHRIS

Method for detecting swine epidemic diarrhea by reverse transcription-loop-mediated isothermal amplification

The invention provides a method for detecting swine epidemic diarrhea by reverse transcription-loop-mediated isothermal amplification. According to the conserved domain gene of PEDV (Porcine Epidemic Diarrhea Virus) N protein, three pairs of primers aiming at six areas on a target gene are designed, two RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primers are combined, and PED (Porcine Epidemic Diarrhea) viruses are identified by the RT-LAMP (Reverse Transcription-Loop-Mediated Isothermal Amplification) technology; RT-LAMP reacts; reverse transcription is performed on obtained RNA(Ribose Nucleic Acid); and the obtained cDNA is used for PCR reaction. The method provided by the invention ensures amplification specificity, has high amplification speed and can obtain a result within 30-60 minutes, and people can observe amplification effect with eyes without electrophoresis. Reverse transcription and nucleic acid amplification can be realized in 1 hour at the constant temperature of 65 DEG C by using enzyme mixture; RT-LAMP detection is carried out on the basis of LAMD amplification DNA; a reverse transcription enzyme is added to realize amplified detection of RNA; and reverse transcription and amplification are finished in one step so as to omit the reverse transcription step which is firstly carried out by the traditional RT-PCR.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof

The invention discloses a primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof. The primer combination is composed of a primer set I and a primer set II. The primer set I is composed of primers FMDV-F3, FMDV-B3, FMDV-FIP and FMDV-BIP which are sequentially disclosed as Sequence 1-4. The primer set II is composed of primers VSV-F3, VSV-B3, VSV-FIP and VSV-BIP which are sequentially disclosed as Sequence 5-8. The invention also discloses application of the primer combination in identifying foot-and-mouth disease virus and vesicular stomatitis virus, application in identifying whether a virus to be detected is foot-and-mouth disease virus or vesicular stomatitis virus, and application in identifying whether a sample to be detected is infected by foot-and-mouth disease virus and / or vesicular stomatitis virus. The duplex RT-LAMP (reverse transcription-loop-mediated isothermal amplification) method established by the invention is a simple quick low-cost diagnosis method, can be used for grass-root and field quarantine inspection under poor conditions, and is also suitable for large-scale epidemiological survey.
Owner:GUANGXI VETERINARY RES INST

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) visual kit for detecting Japanese B encephalitis virus and application of kit

InactiveCN102399909ALow costReduce use costMicrobiological testing/measurementBetaineJapanese B Encephalitis Virus
The invention discloses a reverse transcription loop-mediated isothermal amplification (RT-LAMP) visual kit for detecting Japanese B encephalitis virus and application of the kit. The visual kit contains a primer group and color development substances, wherein primers have sequences shown as SEQ ID NO.1-4, and the color development substances are calcein and manganese chloride. A using method of the kit comprises the following steps of: preparing an RT-LAMP system containing AMV reverse transcriptase, a 1 time reaction buffer solution, strand displacement DNA polymerase, a dNTP mixture, betaine, calcein, manganese chloride, MgSO4, a forward inner primer (FIP), a backward inner primer (BIP) group, an F3 primer, a B3 primer and RNA of a sample to be detected; performing thermostatic reaction on the reaction system at the temperature of between 61 and 65 DEG C, and inactivating; and judging a result under natural light or ultraviolet or natural light and ultraviolet, wherein if the reaction product is green under the natural light, the sample to be detected contains the Japanese B encephalitis virus; and if the reaction product represents obvious green fluorescence under the ultraviolet, the sample to be detected contains the Japanese B encephalitis virus.
Owner:SOUTH CHINA AGRI UNIV

Method for detecting apple viruses by adopting reverse transcription loop-mediated isothermal amplification technology

The invention relates to a method for detecting apple viruses by adopting a reverse transcription loop-mediated isothermal amplification technology, wherein the method comprises the following steps of total RNA (Ribose Nucleic Acid) extraction of apple viruses, RT-LAMP (reverse transcription loop-mediated isothermal amplification) reaction and electrophoresis detection and virus type determination, wherein the apple viruses are selected from an ASGV (Apple Stem Grooving Virus), an ACLSV (Apple Chlorotic Leaf Spot Virus) and an ASPV (Apple Stem Pitting Virus). According to the invention, an RT-LAMP primer is designed according to the gene conserved region of the apple viruses, and a rapid, flexible and highly specific method for detecting the apple viruses by adopting the one-step method reverse transcription loop-mediated isothermal amplification technology, and a new means for rapid detection of the apple viruses is provided.
Owner:NORTHWEST A & F UNIV

Technology for rapidly detecting rice black-streaked dwarf viruses in plants by reverse transcription-loop-mediated isothermal amplification (RT-LAMP) method

The invention provides a rapid detection technology for rice black-streaked dwarf viruses in plants such as rice, wheat and corn and the like and an application method thereof in the diagnosis of diseases. By the method, the interference of southern rice black-streaked dwarf disease can be eliminated, and plant samples of the rice black-streaked dwarf viruses can be rapidly identified, so that targeted preventive strategies can be used, and the loss brought by the diseases is reduced.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) kit for detecting avian influenza virus subtype H7N9

The invention discloses an RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) kit for detecting avian influenza virus subtype H7N9. The kit comprises six pairs of primers, the nucleotide sequences are shown in SEQ ID No.1-12 respectively. The kit can rapidly, specifically and sensitively detect the avian influenza virus subtype H7N9, a turbidity meter is utilized for judging the reaction in real time, or SYBR Green I is injected after the reaction is finished, and a detection result is judged by color reaction; the lowest detection limit of a primer for detecting HA gene is 48fg / mul of H7N9 RNA; and the lowest detection limit of a primer for detecting NA gene is 4.8pg / mul of H7N9 RNA. The kit is convenient and simple to use, low in cost and good in specificity, is very suitable for disease surveillance, on-site emergency and clinical specimen detection, and is suitable for large-range popularization and application, and the reaction result is easy to observe.
Owner:SOUTH CHINA AGRI UNIV +1

H6 subtype avian influenza virus RT-LAMP (reverse transcription loop-mediated isothermal amplification) kit

The invention discloses an H6 subtype avian influenza virus RT-LAMP (reverse transcription loop-mediated isothermal amplification) kit. A reverse transcription loop-mediated isothermal amplification (RT-LAMP) technology is adopted; and six specific primers of LAMP are designed according to eight loci in a conserved region of an H6 subtype AIV (avian influenza virus) hemagglutinin (HA) gene sequence. Due to the application of the H6 subtype avian influenza virus RT-LAMP kit and a detection method established by the invention, the defects of long detection period, low sensitivity, poor specificity, complex operation, high instrument requirement in the prior art are overcome. The H6 subtype avian influenza virus RT-LAMP kit is particularly suitable for the requirement on field detection of the H6 subtype avian influenza virus in the primary-level areas and frontier ports and has important significance for preventing and controlling the H6 subtype avian influenza virus.
Owner:GUANGXI VETERINARY RES INST

Swine acute diarrhea syndrome coronavirus primer combination and kit and method thereof

The invention discloses a swine acute diarrhea syndrome coronavirus primer combination and a kit and method thereof. The swine acute diarrhea syndrome coronavirus primer combination and the kit and method thereof aim at providing an SADS (swine acute diarrhea syndrome) detecting primer and method high in sensitivity and specificity. The swine acute diarrhea syndrome coronavirus primer combinationis composed of a forward inner primer of SADS-FIP, a backward inner primer of SADS-BIP, a forward outer primer of SADS-F3, a backward outer primer of SADS-B3, a forward loop primer of SADS-LF and a backward loop primer of SADS-LB. The detecting method of the swine acute diarrhea syndrome coronavirus primer combination comprises 1) extracting RNA (ribonucleic acid) of virus from a sample; 2) takingthe extracted RNA as a template, and establishing an RT-LAMP(reverse transcription-loop-mediated isothermal amplification) system through the RT-LAMP primer combination of SADS to perform RT-LAMP ata constant temperature of 60-65 DEG C; 3) detecting amplification products through a DEAOU-308C thermostatic fluorescence detector. The swine acute diarrhea syndrome coronavirus primer combination andthe kit and method thereof belong to the field of biological detecting technology.
Owner:ZHEJIANG UNIV +1

Method for detecting bovine viral diarrhea viruses as well as preparation method and use method of reverse transcription loop-mediated isothermal amplification (RT-LAMP) reaction kit

The invention provides a method for detecting bovine viral diarrhea viruses as well as a preparation method and a use method of a reverse transcription loop-mediated isothermal amplification (RT-LAMP) reaction kit, relating to a preparation method and a use method of a reaction kit. The invention solves the problems that the traditional method for detecting bovine viral diarrhea viruses has expensive cost, needs professional equipment and professional staff to participate in detection, and is not suitable for the development state of the animal husbandry at the present stage of China. The preparation method comprises the following steps: firstly, designing a primer, preparing RT-LAMP reaction liquid, and then, finishing the preparation. The use method comprises the following steps: adding RNA extract containing bovine viral diarrhea virus samples into the reaction liquid, ungergoing RT-LAMP reaction after mixing, and then, centrifugally detecting; or adding 10,000*SYBR GREEN I, and putting below an ultraviolet lamp for detecting; or carrying out electrophoresis detection; or carrying out insulation reaction detection by adopting a Real-time PCR instrument. The reaction kit has convenient detection, does not need expensive instruments and reduces the cost.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

RT-LAMP (reverse transcription-loop-mediated isothermal amplification) primers and kit for detecting pepper veinal mottle virus

The invention belongs to the field of plant virus detection, and particularly relates to RT-LAMP (reverse transcription-loop-mediated isothermal amplification) primers and a kit for detecting pepper veinal mottle virus. The RT-LAMP primers are designed according to CP gene of pepper veinal mottle virus, and comprise a pair of outer primers F3 and B3 and a pair of inner primers FIP and BIP. The RT-LAMP detection kit for pepper veinal mottle virus comprises the RT-LAMP primers, an RT-LAMP reaction solution, an enzyme solution and a nucleic acid fluorescent dye. The detection method comprises the following steps: by using total RNA (ribonucleic acid) of a sample to be detected as a template, carrying out RT-LAMP amplification reaction at 65 DEG C for 60 minutes by using the RT-LAMP primers or RT-LAMP detection kit, reacting at 80 DEG C for 5 minutes, and further identifying whether the sample to be detected is infected by the pepper veinal mottle virus. The primers and kit are simple to operate, have the advantages of high speed, high accuracy and high specificity, and do not need any special instrument or equipment.
Owner:PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI

PRRS rt-lamp detection method and detection kit

The invention discloses a simple, rapid and specific RT-PCR detection method and detection kit for PRRS. The present invention uses reverse transcription loop-mediated isothermal amplification technology (RT-LAMP), designs 2 pairs of specific primers in 6 regions of the ORF7 gene conservative sequence of PRRSV nucleocapsid protein (N protein), and optimizes the reaction system and reaction conditions As well as sensitivity and specificity tests, a RT-LAMP detection method for PRRSV was established. The research results show that this detection method does not require complicated instruments, and the nucleic acid amplification reaction can be completed by only using an ordinary constant temperature water bath and incubating at isothermal conditions (63°C) for 1 hour. The accurate judgment of the test results provides a cheap, simple, fast, high sensitivity and good specificity new method for the detection of PRRS in the field, field and grassroots departments.
Owner:中华人民共和国珠海出入境检验检疫局

Reverse transcription loop-mediated isothermal amplification test kit of hog cholera virus and application thereof

The invention discloses a reverse transcription loop-mediated isothermal amplification test kit of a hog cholera virus and an application thereof. The test kit comprises an RT-LAMP primer, a 2*reaction buffer solution, an EM, a fluorescence visual detection reagent, ultrapure water and a hog cholera virus RNA template. The RT-LAMP primer comprises outer primers F3 and B3, inner primers FIP and BIP and a loop primer LF. The specific detection, the sensibility detection and the fluorescence visual detection prove that by adopting the RT-LAMP detecting method, the hog cholera virus can be specifically detected, the reaction can be real-time monitored, the copy number of the hog cholera virus can be quantitatively determined, the detecting result can be rapidly and accurately obtained, so that the simple, rapid and reliable detection of the hog cholera virus are facilitated.
Owner:GUANGXI VETERINARY RES INST

RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection kit and RT-LAMP detection method for SVCV (spring viremia of carp virus)

The invention discloses a RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection kit and a RT-LAMP detection method for SVCV (spring viremia of carp virus). The RT-LAMP detection kit of SVCV comprises 10*ThermoPol Reaction buffer, Bst DNA (deoxyribonucleic acid) polymerase, dNTPs (deoxynucleoside triphosphates), AMV reverse transcriptase, outer primer F3 and B3, inner primer FIP, BIP and Betaine, MgC 12, DTT, and 1000*SYBR Green I. The RT-LAMP detection kit is simple, fast, and high in specificity and sensitivity, only needs a water bath kettle or a metal bath to accurately detect SVCV in samples in 2 hours, can detect SVCV of infected tissues of sick fish, can detect cells infected by SVCV, and is suitable for fast field detection of SVCV.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Reverse transcription-loop-mediated isothermal amplification (RT-LAMP) visual detection kit for H1N2 avian influenza viruses

The invention discloses a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) visual detection kit for H1N2 avian influenza viruses. The kit comprises a set of LAMP primers for detecting or assisting to detect the H1 avian influenza viruses and N2 avian influenza viruses. The primers consist of a degenerate primer FIP-H1, a degenerate primer BIP-H1, a degenerate primer F3-H1, a degenerate primer B3-H1, a degenerate primer LF-H1, a degenerate primer LB-H1, a degenerate primer FIP-N2, a degenerate primer BIP-N2, a degenerate primer F3-N2, a degenerate primer B3-N2, a degenerate primer LF-N2 and a degenerate primer LB-N2. The nucleotide sequences of the primers are shown by a sequence 1, a sequence 2, a sequence 3, a sequence 4, a sequence 5, a sequence 6, a sequence 7, a sequence 8, a sequence 9, a sequence 10, a sequence 11 and a sequence 12 in a sequence table. The RT-LAMP visual detection kit for the H1N2 avian influenza viruses has the advantages that the specificity is strong, the sensitivity is high, instrument equipment and operations are simple, and results can be conveniently observed. The RT-LAMP visual detection kit for the H1N2 avian influenza viruses is especially suitable for performing rapid diagnosis and early screening on the H1 avian influenza viruses and the H1N2 avian influenza viruses in basic-level veterinary stations, farms and frontier ports.
Owner:GUANGXI VETERINARY RES INST

One-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus

The invention discloses a one-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus. The primer group is used to carry out RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) reaction; the reaction product is placed to 1% of TBT (Tetrabromoethane) agar gel for electrophoresis or visualization is carried out to the amplification product by using a fluorescent dye SYBR Green I; if the reaction is positive, the soybean mosaic virus exists; if the reaction is negative, the to-be-detected sample does not contain soybean mosaic virus. According to the one-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus disclosed by the invention, the RNA (Ribonucleic Acid) quick crude extracting method is combined with the RT-LAMP detection, so that the total RNA nucleic acid of the quickly and crudely extracted to-be-detected sample is used as a reaction template of the RT-LAMP, therefore, the redundancy time for the conventional RNA extracting method of the RT-LAMP is saved, the operation process is simplified, the detection speed is improved, and the one-step detection for the soybean mosaic virus is realized.
Owner:NANJING AGRICULTURAL UNIVERSITY

Coxsackie virus A16 type RT-LAMP (reverse transcription-loop-mediated isothermal amplification) nucleic acid assay kit

The invention relates to the field of biological assay technical application, and in particular relates to a coxsackie virus A16 type RT-LAMP (reverse transcription-loop-mediated isothermal amplification) nucleic acid assay kit. The kit comprises RT-LAMP reaction solutions containing four RT-LAMP primers, as well as 10000X SYBR Green I dye. The kit has the characteristics of good specificity, high sensitivity, simple operation method, quick assay, easily judged result, low cost and the like, can well fulfill the current urging requirement for field assay of hand-foot-and-mouth disease, can beused for field quick assay of disease prevention and control institutions, hospitals and kindergartens, is easy for large-scale popularization and application in grass-roots places, and has wide market prospect and great economical and social benefit.
Owner:何雅青 +2

RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid test strip kit for detecting Japanese B encephalitis virus and application of kit

The invention discloses an RT-LAMP (Reverse Transcription Loop-mediated Isothermal Amplification) nucleic acid test strip kit for detecting a Japanese B encephalitis virus and an application of the kit. The RT-LAMP nucleic acid test strip kit comprises a primer group and a nucleic acid detection test strip, wherein nucleotide sequences of the primer group are as shown in SEQ ID NO.1-6. A use method of the RT-LAMP nucleic acid test strip kit comprises the following steps that an RT-LAMP reaction system is prepared to carry out a thermostatic reaction; a product obtained through the thermostatic reaction is detected by using the nucleic acid detection test strip and then directly interpreted; a positive result is that two red strips appear, wherein one red strip is positioned in a detection area, and the other red strip is positioned in a quality control area. The RT-LAMP nucleic acid test strip kit disclosed by the invention has the advantages of easiness for operation, low cost, easiness for observation of reaction result and good specificity, is very suitable for export quarantine, food sanitation and site detection of a livestock cultivation farm and is easy to popularize and apply at a large range.
Owner:广州易安生物技术有限公司

RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) detection method, RT-LAMP primer group and kit for mulberry vein banding virus as well as application

The invention discloses a RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) detection primer group for a mulberry vein banding virus. The RT-LAMP detection primer group comprises an outer primer pair MVBV-F3 and MVBV-B3 and an inner primer pair MVBV-FIP and MVBV-BIP. Therefore, an RT-LAMP detection method and a kit for the mulberry vein banding virus are invented. The RT-LAMP detection primer group, the RT-LAMP detection method and the kit for detecting the mulberry vein banding virus, disclosed by the invention, have the characteristics of high specificity, simple operation and high sensitivity; no special instrument is needed; a result can be judged by observing color change with naked eyes; no electrophoresis, ultraviolet observation and other steps are needed; the RT-LAMP detection primer group, the RT-LAMP detection method and the kit are suitable for mulberry sapling production and detection of MVBV on field mulberry, can be applied to early diagnosis of the mulberry vein banding virus, epidemiology research and the like, and are suitable for carrying out MVBV detection in basic units.
Owner:GUANGXI UNIV

Establishment of reverse transcription loop-mediated isothermal amplification (RT-LAMP) detection method for Prunus necrotic ringspot virus (PNRSV)

The invention discloses establishment of a reverse transcription loop-mediated isothermal amplification (RT-LAMP) detection method for Prunus necrotic ringspot virus (PNRSV). According to the RT-LAMP detection method for the PNRSV, four specific primers are designed for six regions of a target gene PNRSV, a type of strand displacement deoxyribonucleic acid (DNA) polymerase is utilized at the constant temperature of around 65 DEG C, and efficient amplification of nucleic acids can be achieved in dozens of minutes. The four specific primers are used for identifying the six specific sequence regions of a target sequence, and therefore high specificity of amplification of LAMP is guaranteed. In the process of LAMP, thermal denaturation of template is not needed, temperature is cycled for a long time, the amplification is carried out under isothermal conditions, a waste of time due to temperature change is not caused, and the reaction speed can be increased by 30-50%. Based on whether visible white precipitate of magnesium pyrophosphate exists in a reaction tube, whether the nucleic acids are amplified can be easily judged. The RT-LAMP method for detection of the PNRSV is high in specificity, and the RT-LAMP method for detection of the PNRSV has the advantages of being rapid, high in efficiency, simple in instrument requirement, simple and convenient to operate, low in cost and easy to popularize and use at the grass-roots.
Owner:XINJIANG AGRI UNIV

RT-LAMP (Reverse Transcription-Loop-Mediated Isothermal Amplification) primer group for detecting Seneca valley virus as well as kit and application

The invention relates to the technical field of biotechnologies and in particular relates to an RT-LAMP (Reverse Transcription-Loop-Mediated Isothermal Amplification) primer group for detecting a Seneca valley virus as well as a kit and application. The RT-LAMP primer group for detecting the Seneca valley virus has nucleotide sequences shown as SEQ ID NO. 1-6. The invention further provides a kitcomprising the primer group. The kit adopts a reverse transcription-loop-mediated isothermal amplification technology, depends on primers capable of identifying six specific regions on a target sequence and BstDNA polymerase which has an unwinding function and enables the target sequence to be in loop-mediated isothermal amplification, and is capable of efficiently, rapidly and specifically amplifying the target sequence under isothermal conditions. The primer group and the kit disclosed by the invention are applicable to export quarantine, food hygiene and field detection of livestock farms and are convenient for wide-range popularization and application.
Owner:SOUTH CHINA AGRI UNIV

RT-LAMP (reverse transcription loop-mediated isothermal amplification) primer group for detecting porcine epidemic diarrhea virus, kit and application

The invention discloses an RT-LAMP (reverse transcription loop-mediated isothermal amplification) primer group for detecting a porcine epidemic diarrhea virus, a kit and application. The primer group is shown as SEQ ID NO:1 to 6; the kit comprises the RT-LAMP primer group, 2*reaction buffer liquid, EM, ultrapure water and a porcine epidemic diarrhea virus RNA (ribonucleic Acid) template. The method comprises the steps of material preparation, RT-LAMP primer design and synthesis, virus genome RNA extraction, RT-LAMP reaction system building, and specific detection, sensibility detection and real-time quantitative detection by an RT-LAMP detection method. The specific detection and the sensibility detection prove that the RT-LAMP kit provided by the invention can monitor the reaction in real time and can perform quantitative detection on the porcine epidemic diarrhea virus copying number; the detection result can be fast and accurately obtained; convenience is brought for simply, conveniently, fast and reliably detecting the porcine epidemic diarrhea virus.
Owner:GUANGXI VETERINARY RES INST

RT-LAMP (reverse transcription loop-mediated isothermal amplification) primer set and kit for detecting porcine epidemic diarrhea virus and application thereof

The invention discloses an RT-LAMP (reverse transcription loop-mediated isothermal amplification) primer set and kit for detecting porcine epidemic diarrhea virus and application thereof. The primer set is composed of a pair of outer primers, a pair of inner primers and a pair of loop primers. Sequences of the paired outer primers are shown in SEQ ID No.1 and SEQ ID No.2. Sequences of the paired inner primers are shown in SEQ ID No.3 and SEQ ID No.4. Sequences of the paired loop primers are shown in SEQ ID No.5 and SEQ ID No.6. The primer set is effective in detecting the porcine epidemic diarrhea virus. The kit comprises the afore-mentioned primers and is applicable to detecting the porcine epidemic diarrhea virus. The invention further provides a method of detecting the porcine epidemic diarrhea virus with the kit; detection results of the method may be visually detected according to changes in the color of reaction liquid, quickly and accurately. The primer set, the kit and the method are highly specific, highly sensitive and quick and accurate in detecting the porcine epidemic diarrhea virus and are particularly applicable to quick field detection.
Owner:HEBEI AGRICULTURAL UNIV.

Reverse transcription loop-mediated isothermal amplification kit for detecting pestedes petits ruminants viruses

The invention discloses a reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for detecting pestedes petits ruminants viruses (PPRVs). The kit comprises an RT-LAMP primer, a 2X reaction buffer solution, an enzyme mixture (EM), a fluorescent visual detection reagent, ultrapure water and a reaction template, wherein the RT-LAMP primer includes outer primers F3 and B3, inner primers FIP and BIP and loop primers LF and LB. The detection kit is mainly used for detecting whether the PPRVs exist in lesion tissues suspiciously infected with the PPRVs. Specific detection and sensitivity detection prove that the RT-LAMP kit provided by the invention can monitor a reaction in real time and quantitatively detect a copy number of the PPRVs, a detection result is obtained quickly and accurately, and the convenience is brought for simply and quickly detecting the PPRVs.
Owner:GUANGXI VETERINARY RES INST

Method for detecting porcine sapeloviruses based on reverse transcription loop-mediated isothermal amplification technology

The invention relates to the application field of biotechnology, and provides a method for detecting porcine sapeloviruses based on a reverse transcription loop-mediated isothermal amplification technology. The method comprises the following steps: screening a conserved sequence block 5' UTR of the porcine sapeloviruses and designing four primers according to the conserved sequence block; preparing a sample to be detected; preparing a reaction liquid and carrying out a reverse transcription loop-mediated isothermal amplification reaction (RT-LAMP); and identifying a reaction result according to the real-time detection of an amplification curve output by a turbidity meter, the color changing conditions of the calcein of a fluorescent dye or the direct observation of the turbidity change of the reaction liquid. For relevant detection departments or companies, the method which is low in price, rapid in speed, high in efficiency and high in specificity is provided.
Owner:SHANGHAI JIAO TONG UNIV

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting rice black-streaked dwarf viruses in plant hopper

The invention provides a rapid detection technology for rice black-streaked dwarf viruses in plant hopper and a method for applying the rapid detection technology to disease diagnosis and prediction. By the method, the interference of southern rice black-streaked dwarf viruses can be eliminated, and whether the rice black-streaked dwarf viruses are carried in the plant hopper is rapidly identified, so that a pertinent control strategy is adopted to reduce the loss caused by diseases.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

RT-LMAP (reverse transcription loop-mediated isothermal amplification) agent for detecting Arabis mosaic virus as well as preparation method and application thereof

The invention discloses an RT-LMAP (reverse transcription loop-mediated isothermal amplification) agent for detecting Arabis mosaic virus as well as a preparation method and an application thereof. The agent is well-designed and synthesized by selecting a CP coding gene fragment as a target sequence, which is specific to Arabis mosaic virus and relatively conserved among individual strains. The agent comprises three pairs of specific primers and has a target fragment length of 226 bp; and the sequences of the primers are as follows: ccccgttccattcactaacaactcttttattggtggtatggtcaaggg, and actggaatcaactgtttaaataccccgtttttagggggagcgaatttcaat; taatacactcttgagttactatctagg, and taagcgcagtggagttcgat; and tgccataagtgcaagggct, and tgttacatcgaggaggatgg. The invention overcomes the problems that the conventional RT-PCR method takes a long period of time, needs expensive equipment and requires electrophoresis after amplification, achieves the purpose of rapid, accurate and qualitative detection of ArMV (Arabis mosaic virus) in samples, and has the advantages of low cost, simplicity and easiness in operation, visual detection result, high sensitivity, good reproducibility and the like.
Owner:NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products