Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting swine epidemic diarrhea by reverse transcription-loop-mediated isothermal amplification

A porcine epidemic diarrhea, ring-mediated isothermal technology, applied in the field of molecular biology, can solve the problems of non-specific amplification, long amplification time, unfavorable promotion and application in grass-roots laboratories, etc. The effect of shortening the detection time

Inactive Publication Date: 2011-04-20
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Disadvantages of PCR: (1) Often cause non-specific amplification
(2) Requires more expensive PCR instrument
(3) Amplification takes a long time, usually several hours, which is not conducive to popularization and application in grassroots laboratories

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting swine epidemic diarrhea by reverse transcription-loop-mediated isothermal amplification
  • Method for detecting swine epidemic diarrhea by reverse transcription-loop-mediated isothermal amplification
  • Method for detecting swine epidemic diarrhea by reverse transcription-loop-mediated isothermal amplification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1: A method for detecting porcine epidemic diarrhea by reverse transcription-loop-mediated isothermal amplification of the present invention, the steps are as follows:

[0033] Step 1: Design primers: According to the conserved region gene of PEDV N protein, design 3 pairs of primers targeting 6 regions (underlined parts) on the target gene: FIP, BIP, F3, B3, F-loop, B-loop; synthesized according to the literature Two RT-PCR primers (PED1, PED2), the primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd., the template and primer sequences are as follows:

[0034] AATCCAGGGCCACTTCGA A GGAACGTGACCTCAAAAGACA TCCC

[0035] AGAGTGGAGGAGAATTCCCAA GGGCGAAAATAGCGTAGCAGCT

[0036] TGCTTC GGACCCAGAGGGGGCTTCAA AAACTTTGGAGATGCGG

[0037] AATTTGTCGAAAAAG GTGTTGATGCGTCAGGCT AT GCTCAGATC

[0038] GCCAGTTTAGC

[0039]

[0040] Step 2: Preparation of virus: Vero cells in good condition were inoculated in a 6-well plate, placed at 37°C, 5% CO...

Embodiment 2

[0051] Example 2: Combining figure 1 , a reverse transcription-circle-mediated isothermal amplification method for detecting porcine epidemic diarrhea according to the invention, 3 pairs of primers are designed for 6 regions on the target gene, which improves the specificity of the reaction and reduces the generation of non-specific reactions. Since the LAMP reaction is carried out under constant temperature conditions, the equipment is simple and only needs a water bath. The LAMP reaction does not require thermal denaturation to change the double-stranded DNA into a single strand like the PCR reaction, because the double-stranded DNA is in a state of dynamic equilibrium at about 65°C, and any primer and the complementary part of the double-stranded DNA perform base pairing extension. At that time, the other chain will fall off and become a single chain. The LAMP method utilizes this characteristic to carry out the reaction. It does not need to carry out multiple temperature...

Embodiment 3

[0052] Example 3: Technical principle: In 2000, Japanese scholar Notomi et al. invented a new method called loop-mediated isothermal amplification (LAMP). This method uses 4 (or 6) different specific primers to identify 6 specific regions of the target gene, and can perform amplification reactions under isothermal conditions. High amplification efficiency, can amplify 10 in 15-60min 9 ~10 10 times.

[0053] Primer design:

[0054] Three pairs of primers were designed based on 6 different sites including the F3c, F2c and F1c regions at the 3' end of the target gene and the B1, B2 and B3 regions at the 5' end. FIP primer: upstream internal primer, consisting of F2 region, F2 region is complementary to the F2c region at the 3' end of the target gene, and has the same sequence as the F1c region at the 5' end of the target gene. F3 Primer: An upstream external primer consisting of the F3 region and complementary to the F3c region of the target gene. BIP primer: downstream inte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting swine epidemic diarrhea by reverse transcription-loop-mediated isothermal amplification. According to the conserved domain gene of PEDV (Porcine Epidemic Diarrhea Virus) N protein, three pairs of primers aiming at six areas on a target gene are designed, two RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primers are combined, and PED (Porcine Epidemic Diarrhea) viruses are identified by the RT-LAMP (Reverse Transcription-Loop-Mediated Isothermal Amplification) technology; RT-LAMP reacts; reverse transcription is performed on obtained RNA(Ribose Nucleic Acid); and the obtained cDNA is used for PCR reaction. The method provided by the invention ensures amplification specificity, has high amplification speed and can obtain a result within 30-60 minutes, and people can observe amplification effect with eyes without electrophoresis. Reverse transcription and nucleic acid amplification can be realized in 1 hour at the constant temperature of 65 DEG C by using enzyme mixture; RT-LAMP detection is carried out on the basis of LAMD amplification DNA; a reverse transcription enzyme is added to realize amplified detection of RNA; and reverse transcription and amplification are finished in one step so as to omit the reverse transcription step which is firstly carried out by the traditional RT-PCR.

Description

(1) Technical field [0001] The invention relates to molecular biology, in particular to a method for detecting porcine epidemic diarrhea by reverse transcription-circle-mediated isothermal amplification. (2) Background technology [0002] Loop-mediated isothermal amplification technology (LAMP, Loop-mediated Isthermal Amplification) is a sensitive strand-substituted nucleic acid amplification technology, which was invented by Japanese scholar Notomi et al. in 2000. Its characteristic is to design 4 kinds of specific primers for 6 regions of the target gene, and use a strand displacement DNA polymerase (Bst DNA polymerase) to incubate at a constant temperature for tens of minutes to complete the amplification reaction, within 1 hour, Amplify the target DNA fragment for 10 9 ~10 10 times, and does not require thermal denaturation of the template, long-term temperature cycling and other processes, which is convenient for popularization and application. RT-LAMP is based on LA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 任晓峰李鹏冲李广兴
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com