Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

One-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus

A soybean mosaic virus and isothermal amplification technology, which is applied in the field of temperature amplification detection, can solve the problems of rapid detection without being used, and achieve the effects of saving redundant time, simplifying the operation process, and speeding up the inspection speed.

Inactive Publication Date: 2013-06-12
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This technology has also been gradually applied to the detection of plant viruses, but RT-LAMP detection has not been used for the rapid detection of SMV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • One-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus
  • One-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus
  • One-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Soybean mosaic virus RT-LAMP primer set design and screening:

[0038] By comparing the SMV coat protein (CP) sequences of different strains in GenBank, the SMV CP conserved region sequence shown in SEQ ID NO. 5 (GenBank: HM590055.1) was found as the template reference sequence, using online LAMP Primer design software primerExplorer V4( http: / / primerexplorerjp / elamp4.0.0 / index.html) Design 4 sets of primer sets, the primer sets are as follows:

[0039] Primer set I:

[0040] F3-I: GCCATTAGCATCTGGAGAT (SEQ ID NO.6)

[0041] B3-I: CTTGCTTGAGTACAAACCTAA (SEQ ID NO.7)

[0042] FIP-I: ACGATGAGCAGATGGGTGTGTACCATTGTCAATGCACCATA (SEQ ID NO. 8)

[0043] BIP-I: TCTTTAACTGCATTGTACCACGCGGTTGATTTATTCAACACTCGA (SEQ ID NO.9)

[0044] Primer set II:

[0045] F3: AGATGTAAATGTTGGATC (SEQ ID NO.1)

[0046] B3: TCATCATCAAGCTCATATT (SEQ ID NO.2)

[0047] FIP: ATCTTCCCTTCAACCATTGGAAGAAGGTGGTTCCGCGTTTGCAGAAG (SEQ ID NO.3)

[0048] BIP: CCTAATCAGGTTGATTTATTCAAATCTTTAACTGCATTGTACCACGC (SEQ ID NO....

Embodiment 2

[0065] Example 2 Optimization experiment of RT-LAMP reaction system of soybean mosaic virus

[0066] (1) To optimize the Mg ion concentration, add 25mM MgSO sequentially according to the reaction system 4 : 0.8, 1.2, 1.6, 2.0, 2.4, 2.8ul.

[0067] (2) To optimize the concentration of betaine, add 5M betaine in sequence according to the reaction system: 0.8, 1.2, 1.6, 2.0, 2.4, 2.8ul.

[0068] (3) To optimize the dNTP concentration, add 10mM dNTP in sequence according to the reaction system: 0.4, 0.6, 0.8, 1.0, 1.2, 1.4ul.

[0069] (4) To optimize the concentration of internal primers (FIP, BIP), add (FIP, BIP) in sequence according to the reaction system: 0.2, 0.3, 0.4, 0.5, 0.6, 0.7. At this time, the outer primers are all 0.2ul.

[0070] The control group uses the original reaction system (see Example 1), the blank control is a control without any RNA, the positive control uses a plasmid, and the optimized reaction tube adds the extracted total RNA of the soybean sample with SMV.

[0...

Embodiment 3

[0075] Example 3 Comparison of sensitivity of RT-LAMP and RT-PCR

[0076] In order to determine the sensitivity of the two detection methods of RT-LAMP and RT-PCR, the extracted total RNA was measured with a spectrophotometer and then RNAse-Free ddH 2 Dilute with O and store at -70°C as a template. Perform 10 steps on 100ng RNA template in sequence -1 It was diluted to 0.001 ng, 1 ul RNA was used as a template, and primer set II was used to react according to the system in Example 2. Take 2ul of the amplified product and load it on a 1% agarose gel. At the same time, the same RT-LAMP template is used, B3 is the reverse transcription primer, and the first strand of cDNA is synthesized by reverse transcription according to the instructions of AMV reverse transcriptase. The cDNA synthesized by RT was used as a template, and F3 and B3 were used as primers for PCR amplification, using a conventional reaction system. Take 2ul of the amplified product and load it on a 1% agarose gel. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a one-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus. The primer group is used to carry out RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) reaction; the reaction product is placed to 1% of TBT (Tetrabromoethane) agar gel for electrophoresis or visualization is carried out to the amplification product by using a fluorescent dye SYBR Green I; if the reaction is positive, the soybean mosaic virus exists; if the reaction is negative, the to-be-detected sample does not contain soybean mosaic virus. According to the one-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus disclosed by the invention, the RNA (Ribonucleic Acid) quick crude extracting method is combined with the RT-LAMP detection, so that the total RNA nucleic acid of the quickly and crudely extracted to-be-detected sample is used as a reaction template of the RT-LAMP, therefore, the redundancy time for the conventional RNA extracting method of the RT-LAMP is saved, the operation process is simplified, the detection speed is improved, and the one-step detection for the soybean mosaic virus is realized.

Description

Technical field [0001] The invention belongs to the field of biological monitoring, and relates to a one-step loop-mediated reverse transcription isothermal amplification detection method of soybean mosaic virus. Background technique [0002] Soybean mosaic virus (SMV) is a very destructive virus that is widely distributed in many countries in the world, and it brings huge agricultural economic losses to many countries every year. Because the disease is widely distributed and common in the world, resulting in a serious reduction in soybean production and germplasm decline, the development of rapid detection methods for SMV virus disease is very important for the diagnosis of the disease, accurately grasping the epidemic law of the disease and proposing effective control measures. important. The current detection of soybean mosaic virus disease includes biological identification, electron microscopy identification, enzyme-linked immunological reaction (ELISA) and reverse transcri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/94
Inventor 陶小荣张雯娜卫其巍
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com