42 results about "Tetrabromoethane" patented technology

The present invention relates to a catalyst composition for ethylene oligomerization and the use thereof. Such catalyst composition includes chromium compound, ligand containing P and N, activator and accelerator; wherein the chromium compound is selected from the group consisting of acetyl acetone chromium, THF-chromium chloride and Cr(2-ethylhecanoate)3; general formula of the ligand containing P and N is shown as:in which R1, R2, R3 and R4 are phenyl, benzyl, or naphthyl. R5 is isopropyl, butyl, cyclopropyl, cyclopentyl, cyclohexyl or fluorenyl; the activatior is methyl aluminoxane, ethyl aluminoxane, propyl aluminoxane and / or butyl aluminoxane; the accelerator is selected from the group consisting of 1,1,2,2,-tetrachloroethane, 1,1,2,2-tetrabromoethane, 1,1,2,2-tetrafluoroethane, and compounds having a formula of X1R6X2, in which X1 and X2 are F, Cl, Br, I or alkoxyl, R6 is alkylene or arylene group; the molar ratio of chromium compound, ligand containing P and N, activator and accelerator is 1:0.5˜10:50˜3000:0.5˜10. After mixing the four components mentioned previously under nitrogen atmosphere for 10 minutes, they are incorporated to the reactor, or these four components are incorporated directly into the reactor. Then ethylene is introduced for oligomerization. Such catalyst can be used in producing 1-octene through ethylene oligomerization. It is advantageous in high catalysing activity, high 1-octene selectivity, etc. The catalytic activity is more than 1.0×106 g product·ma−1 Cr·h−1, the fraction of C8 linear α-olefin is more than 70% by mass.

The invention relates to a method for producing trimellitic anhydride by a continuous oxidation process, which uses trimellitic acid as a raw material, acetic acid as a solvent, and cobalt acetate, manganese acetate, tetrabromoethane or hydrogen bromide as a catalyst. The production process includes the following process: (1) continuous oxidation reaction process of the above mixed material; (2) anhydride forming process; (3) refining process; (4) slicing or granulating process; (5) solvent recovery process. Its advantage is that it adopts continuous oxidation technology and advanced refining technology, so that the yield of the product can reach 120%. Compared with the batch oxidation process, this process has the characteristics of high production safety, complete oxidation reaction, stable product quality, low consumption of raw and auxiliary materials, long service life of equipment, and is suitable for large-scale industrial production. In the production technology, the production scale is small, the product quality fluctuates greatly, the product yield is low, the energy consumption is high, and the service life of the equipment is short. Therefore, the process of the present invention has good promotion value.

The invention discloses an anti-anthracnose molecular diagnostic kit for a pod bean, which is characterized by consisting of a specific primer 1 of GGATCCATGCAAGGAACCTCCAAAGAC, a specific primer 2 of ATTACTTGTGGAATTTTCCATGAGTCGACA, dNTP, a Tag polymerase, a PCR (Polymerase Chain Reaction) buffer solution, a DNA template, a sterile deionized water, a 6x upper sample buffer solution, a TBE (Tetrabromoethane) electrophoretic buffer solution and a standard positive marker. The consistency of the detection result of the kit disclosed by the invention to the field is as high as 96%; the detection repeatability is as high as 100%; the specificity is as high as 100%, simultaneously the kit has the characteristics of being simple, convenient, quick, accurate,and not influenced by season of growth, environmental conditions and the like; detection can be performed in a lab, so a great quantity of land, labor and materials are saved; the breeding time is shortened, and the kit has important application value in bean breeding.

The invention relates to a method for increasing tricalcium silicate content of Portland cement powder. The method comprises the following steps: adding the Portland cement powder into a heavy fluid 1, uniformly mixing, centrifuging, and taking a lower-layer sample after centrifugation, wherein the heavy fluid 1 is obtained by blending diiodomethane and tetrabromoethane according to a volume ratio of 0.53: 1; adding a heavy fluid 2 into the lower-layer sample, uniformly mixing, centrifuging, and taking an upper-layer sample after centrifugation as the Portland cement powder with high tricalcium silicate content, wherein the heavy fluid 2 is obtained by blending diiodomethane and tetrabromoethane according to a volume ratio of 2: 1. The method is simple in process; increase in tricalcium silicate in cement clinker is achieved by changing improvement in the cement clinker calcining process into physical sorting after calcining; and the method is insusceptible to dosing and calcining process factors and the like.

A method for preparing 3,3',4,4'-benzophenone tetracarboxylic acid by liquid-phase air oxidation method, which relates to a preparation method of 3,3',4,4'-benzophenone tetracarboxylic acid . It solves the problems of using a highly toxic purification solvent, difficulty in adding materials, low purity and low yield in the process of preparing 3,3',4,4'-benzophenone tetracarboxylic acid in the prior art. The method step is to mix 3,3',4,4'-tetramethyldiphenylethane, glacial acetic acid, cobalt acetate tetrahydrate, manganese acetate tetrahydrate and tetrabromoethane in molar ratio, dissolve and add to the reaction In the kettle, react under the conditions of pressurization, heating and stirring, and then release the pressure, discharge, cool and centrifuge to obtain 3,3',4,4'-benzophenone tetracarboxylic acid. The preparation process of the invention is a weight gain reaction, the product yield is as high as 100-140%, and the product purity is 97.5-99.8%.

The invention provides a stabilizer of tetrabromoethane, which is used for improving the storing stability of tetrabromoethane. The stabilizer is prepared by physically mixing a main stabilizer and an auxiliary stabilizer in a mass ratio of 7:3, wherein the main stabilizer is diethylene glycol or triethylene glycol, the auxiliary stabilizer is a mixture prepared by physically mixing diphenyl isooctyl phosphate, zinc stearate or barium stearate and dehydroacetic acid in a mass ratio of 7 to 3 to 1. The stabilizer of tetrabromoethane has the advantages of stabilizing tetrabromoethane for a longtime, prolonging storage time, making free radicals generated in products of tetrabromoethane captured at any time, avoiding oxidizing reaction, neutralizing hydrogen bromide at any time, inhibiting dehydrobromination, inhibiting automatic catalytic action, stabilizing the acidity and color of tetrabromoethane, and preventing the influence of color change and alkalinity acidity change of productson product quality.

The invention discloses a production process for preparing tetrabromoethane by utilizing a microchannel reactor. The raw material bromine is continuously fed into the microchannel reactor driven by the power system; the acetylene is continuously fed into the microchannel reactor through the gas mass flow controller; the introduced acetylene and bromine are fully mixed in the microchannel reactor, Reaction; through the heat exchange system, the temperature of the reactant is controlled; after the reaction process is completed, the product is collected through the gas-liquid separator; after the collected product is analyzed and qualified, a stabilizer is added and packaged into a product. The production process of the present invention can realize the uniform distribution of acetylene and bromine in the microchannel reactor, make acetylene and bromine fully contact, improve production efficiency and yield, improve the utilization rate of raw material acetylene; avoid the formation of acetylene and air explosive Mixture, improve safety; shorten the process flow, greatly reduce the generation of waste water, waste gas and eliminate by-products.

The invention discloses an acetylene gas purity detection device which comprises a tube body, the tube body sequentially comprises a reaction liquid containing portion, a first plug cock, an absorption tube provided with scales, a second plug cock and a gas inlet tube which can be communicated with one another; the first plug cock comprises a plug cock shell and a valve core rotatably arranged in the plug cock shell, the valve core is provided with a first through hole which enables the reaction liquid containing portion to be communicated with the absorption tube through rotation of the valve core, the plug cock shell is provided with a second through hole matched with the first through hole, and the inner wall of the second through hole above the absorption tube is provided with a protruding block for reducing the radial cross section area of the second through hole. By means of the mode of adding the protruding block, the size of the second through hole can be controlled accurately, the size of the second through hole can be adjusted according to the volume of the absorption tube, and the liquid level of a tetrabromoethane solution is controlled to be lower than the first plug cock.

The invention discloses a composite catalyst and method for preparing trimellitic anhydride. The composite catalyst comprises cobalt acetate, manganese acetate, tetrabromoethane and zirconium acetate, the weight ratio of cobalt acetate to manganese acetate to tetrabromoethane to zirconium acetate in the composite catalyst is 1: (0.3-5): (0.3-5): (0.3-5). According to the method for preparing trimellitic anhydride, pseudocumene is taken as a raw material and acetic acid is taken as a solvent, the composite catalyst is used in the method, and air is used as an oxidizing agent; the weight ratio of pseudocumene to acetic acid to the composite catalyst is 1: (2.5-10): (0.01-0.08), the preparation method comprises the following steps: metering and mixing the raw materials in a mixing kettle according to the proportion, heating and dissolving; transferring the mixed material into an oxidation kettle, introducing air to pressurize, controlling the reaction temperature to be 160-220 DEG C and the pressure to be 0.6-2.2 Mpa, dehydrating the oxide material into crude anhydride in an anhydride forming kettle, and feeding generated dilute acetic acid into a rectifying kettle to be concentrated and recycled. The invention solves the problem that the appearance and color number of the final product are influenced by more impurities in the obtained finished product due to lower conversion rate of pseudocumene and more side reactions in the traditional production method.