Anti-anthracnose molecular diagnostic kit for pod bean and application thereof
An anti-anthracnose and molecular diagnosis technology, which is applied in the direction of DNA/RNA fragments, microbial determination/inspection, recombinant DNA technology, etc., to achieve the effects of shortening the time of seed selection, saving production costs, and saving land
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The detection method is carried out by using known anthracnose-resistant and anthracnose-susceptible bean plants, comprising the following steps:
[0039] (1) Extract genomic DNA from anthracnose-resistant and susceptible kidney beans: Take 100 mg of young kidney bean leaves, cut them into pieces with scissors, place them in a tissue grinder, add 100 μL of extraction buffer solution (1% SDS, 10 mmol / L Tris, 0.3 mol / L EDTA, 1% PVP, pH8.0), fully ground into a homogenate, then add 400μL extraction buffer solution, mix well and incubate in a 90°C water bath for 20 minutes, shake it upside down from time to time, take it out and place Store in an ice bath for 5 minutes at 4°C for later use.
[0040] (2) Determination of DNA concentration: Two methods can be used, one is to measure by ultraviolet spectrophotometer, and the other is to measure by using a self-made known standard gel plate. The general concentration is required to be above 200ng / μL.
[0041] (3) PCR amplific...
Embodiment 2
[0045] The kit for molecular diagnosis of anti-anthracnose in bean pod is characterized in that it is composed of specific primer 1: GGATCCATGCAAGGAACCTCCAAAGAC; specific primer 2: ATTACTTGTGGAATTTTCCATGAGTCGACA; dNTP, Taq polymerase, PCR buffer, DNA template, sterile Composition of ionized water, 6× loading buffer, TBE electrophoresis buffer and standard positive marker: 2.0 μl of 10×PCR buffer solution, 0.2 μl of 10mmol / L dNTP, 1 μl of 10 μmol / L specific primer 1 and 2 , Genomic DNA 400ng of kidney bean, 2 units of Taq polymerase, and sterile water to make up to 25 microliters, put the thin-walled centrifuge tube specially for PCR filled with the above liquid into the PCR amplification instrument, and the amplification conditions are: denaturation at 95°C at 120 Seconds, followed by denaturation at 95°C for 30 seconds, annealing at 55°C for 60 seconds, extension at 70°C for 120 seconds, the number of cycles is 40, and finally extension at 70°C for 480 seconds, the amplificati...
Embodiment 3
[0048] Comparative test:
[0049] The invention is a key method for breeding new varieties of bean for pods resistant to anthracnose. The new bean variety selected and bred by the present invention is an anthracnose-resistant variety that aggregates resistance genes and comprehensive excellent traits. If a disease-resistant variety is used in production, under conditions suitable for the onset of the disease, the bean will not develop disease, and spraying of chemical agents is no longer necessary. potion. Not only the production cost is saved, but also the environmental pollution caused by pesticide residues is reduced. The following comparative experiments are used to further illustrate:
[0050] Table 1: Comparison of artificial seedling inoculation identification and molecular diagnostic kits
[0051]
[0052] Final conclusion: the present invention is similar to the conventional "artificial seedling inoculation identification" in that it is necessary to prepare ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
