Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RT-LAMP (reverse transcription-loop-mediated isothermal amplification) primers and kit for detecting pepper veinal mottle virus

A RT-LAMP, detection kit technology, applied in DNA/RNA fragments, microorganisms, recombinant DNA technology, etc., can solve the problem of low sensitivity, and achieve the effect of rapid identification, strong professionalism and high sensitivity

Inactive Publication Date: 2015-11-11
PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It has the advantage of simple operation, but it needs to prepare virus-specific antiserum or monoclonal antibody, and compared with molecular biology techniques, this method is not sensitive and has a certain false positive rate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RT-LAMP (reverse transcription-loop-mediated isothermal amplification) primers and kit for detecting pepper veinal mottle virus
  • RT-LAMP (reverse transcription-loop-mediated isothermal amplification) primers and kit for detecting pepper veinal mottle virus
  • RT-LAMP (reverse transcription-loop-mediated isothermal amplification) primers and kit for detecting pepper veinal mottle virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] The design of embodiment 1 primer

[0036] According to the capsicum vein mottle virus coat protein (CP) gene sequence registered in GenBank (GenBank sequence accession number: FJ617225), the outer primer pair F3 and B3 and the inner primer pair FIP and BIP were designed. After the design was completed, the primers were listed in the NCBI database. The comparison verification was carried out under the Primer-Blast module, and the following RT-LAMP primer sets were finally selected:

[0037] F3: CTTGAATGGCTTAATGGTTTG;

[0038] B3: CGCTTTCCAATGTACGCT;

[0039] FIP:CTCTTCACCATCAACCATCACCCTGTATAGAAAATGGGACATCGC;

[0040] BIP: ATCCAATTAAGCCATGATTGATTGACCATACTGAAATGCGCCATGA.

Embodiment 2

[0041] The establishment and optimization of embodiment 2 RT-LAMP system

[0042] (1) Experimental materials

[0043] The diseased pepper leaf tissue caused by known pepper vein mottle virus infection and the known healthy pepper leaf tissue were used as materials.

[0044] Capsicum vein mottle virus RT-LAMP detection kit, comprising the following components: RT-LAMP primers designed and synthesized in Example 1; RT-LAMP reaction solution; enzyme solution; nucleic acid fluorescent dye;

[0045] RT-LAMP reaction solution (2×reaction buffer, Rongyan Biotechnology (China) Co., Ltd.) contains the following components: Tris-HCl (pH8.8) 40mM; KCl20mM; MgSO 4 16mM; (NH 4 ) 2 SO 4 20mM; Tween200.2% (w / w); Betaine1.6M; dNTPs each 2.8mM;

[0046] Enzyme solution (Rongyan Biotechnology (China) Co., Ltd.) is a mixed solution of BstDNA polymerase and AMV reverse transcriptase;

[0047] Nucleic acid fluorescent dye (Rongyan Biotechnology (China) Co., Ltd.) is a fluorescent visual detect...

Embodiment 3

[0055] Embodiment 3 Sensitivity experiment to known disease sample detection

[0056] (1) Experimental materials

[0057] Pepper disease-like leaf tissues caused by known pepper vein mottle virus infection and known healthy pepper leaf tissues were used as materials.

[0058] Pepper vein mottle virus RT-LAMP detection kit is the same as in Example 2.

[0059] (2) Experimental method

[0060] The total RNA of the extracted capsicum leaf tissue was divided into 1.0×10 -1 ~10 -8 Concentration gradient dilutions were used as templates for RT-LAMP and ordinary RT-PCR detection respectively, and the detection sensitivities of the two were compared.

[0061] (3) Experimental steps

[0062] (1) Extraction of total RNA from diseased samples: Weigh 0.1g of pepper leaves to be tested into a mortar, grind into a fine powder under liquid nitrogen, transfer the powder to a pre-cooled 1.5mL centrifuge tube quickly, add lmLTrizol Then let stand at room temperature for 10 minutes to full...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant virus detection, and particularly relates to RT-LAMP (reverse transcription-loop-mediated isothermal amplification) primers and a kit for detecting pepper veinal mottle virus. The RT-LAMP primers are designed according to CP gene of pepper veinal mottle virus, and comprise a pair of outer primers F3 and B3 and a pair of inner primers FIP and BIP. The RT-LAMP detection kit for pepper veinal mottle virus comprises the RT-LAMP primers, an RT-LAMP reaction solution, an enzyme solution and a nucleic acid fluorescent dye. The detection method comprises the following steps: by using total RNA (ribonucleic acid) of a sample to be detected as a template, carrying out RT-LAMP amplification reaction at 65 DEG C for 60 minutes by using the RT-LAMP primers or RT-LAMP detection kit, reacting at 80 DEG C for 5 minutes, and further identifying whether the sample to be detected is infected by the pepper veinal mottle virus. The primers and kit are simple to operate, have the advantages of high speed, high accuracy and high specificity, and do not need any special instrument or equipment.

Description

technical field [0001] The invention belongs to the field of plant virus detection, and in particular relates to an RT-LAMP primer and a kit for detecting pepper vein mottle virus. Background technique [0002] Pepper vein mottle virus (PVMV) is a member of the genus Potyvirus in the family Potyviridae. It is transmitted by aphids in a non-persistent manner, and can be transmitted through diseased plant juice and mechanical friction. The virus was mainly reported in African countries to infect peppers and cause serious diseases. Subsequently, Afghanistan, India, South Korea, Taiwan and other Asian countries and regions also reported the occurrence of the virus. In 2005, the virus was detected in Beijing, China, and pepper vein mottle virus was also found in many provinces such as Hunan, Shaanxi, Hainan, Guangxi and Guangdong. The symptoms of diseased plants in the field are mainly manifested as distorted leaf veins, chlorosis between veins and green veins, and mottled leave...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/94
CPCC12Q1/6844C12Q1/70C12Q1/701C12Q2531/119C12Q2521/101
Inventor 汤亚飞何自福佘小漫蓝国兵
Owner PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com