Primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof
A technology for vesicular stomatitis and foot-and-mouth disease virus, which is applied to the primer combination and application field for identifying foot-and-mouth disease virus and vesicular stomatitis virus, and can solve the problems that there are no research reports on double RT-LAMP detection technology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0094] Embodiment 1, design and preparation of primer combinations
[0095] A large number of sequence analyzes and comparisons were carried out to obtain several primer sets for identifying FMDV and several primer sets for identifying VSV. Preliminary experiments were performed on each primer set to compare performances such as sensitivity and specificity, and finally a primer set for identifying FMDV and a primer set for identifying VSV were obtained.
[0096] The primer set used to identify FMDV consists of the following four primers (5'→3'):
[0097] FMDV-F3 (Sequence 1): GAACAACATCCACGTGCTCTAC;
[0098] FMDV-B3 (SEQ ID NO: 2): GGCGTGCAAAGGAGAGGATA;
[0099] FMDV-FIP (Sequence 3): ACGATGTCGTCTCCGTAGGAG- gaattc- TAGACACTATGAGGGAGTTGAGCT;
[0100] FMDV-BIP (Sequence 4): CTGACAAAAGCGACAAAGGTT- gaattc-ACAGGTTTGTAAAACCCAGTTCC.
[0101] The primer set used to identify VSV consists of the following four primers (5'→3'):
[0102] VSV-F3 (SEQ ID NO: 5): GAACTGAAGACAGCACTTC...
Embodiment 2
[0109] Embodiment 2, specificity
[0110] 1. Extract the total RNA of the sample to be tested. The samples to be tested are: VSVNJ type inactivated virus, FMDVO type inactivated virus, equal mixture of FMDVO type inactivated virus and VSVNJ type inactivated virus (referred to as mixed virus), BTV4 type inactivated virus, PPRV vaccine strain, BVDV , BRV or IBRV.
[0111] 2. Take the total RNA obtained in step 1 as a template, and use the primer combination in Example 1 to perform RT-LAMP amplification.
[0112] RT-LAMP amplification reaction system (25μL): 1μL template (including RNA10-100ng), 2.5μL 10×buffer, 15UBstDNA polymerase, 20UAMV reverse transcriptase, 40pmolFMDV-FIP, 40pmolFMDV-BIP, 40pmolVSV-FIP, 40pmolVSV-BIP , 5pmolFMDV-F3, 5pmolFMDV-B3, 5pmolVSV-B3, 5pmolVSV-F3, make up the insufficient volume with water. Set up a blank control in which an equal volume of water is used instead of the template.
[0113] Reaction conditions for RT-LAMP amplification: first react...
Embodiment 3
[0121] Embodiment 3, sensitivity
[0122] 1. Preparation of RNA Standards
[0123] 1. Extract the total RNA of FMDVO type inactivated virus and reverse transcribe it into cDNA.
[0124] 2. Using the cDNA obtained in step 1 as a template, a primer pair consisting of FMDV-B3 and FMDV-F3 is used for PCR amplification to obtain a PCR amplification product. After sequencing, the PCR amplification product is shown as sequence 9 in the sequence listing.
[0125] 3. Using the T7 in vitro transcription kit (Fermentas) and operating according to the instructions, the PCR amplification product obtained in step 2 was transcribed in vitro to obtain RNA A, and passed D 260 Determine the RNA concentration, convert the concentration to copy number according to Avogadro constant, and store at -70°C for later use.
[0126] 4. Extract the total RNA of the VSVNJ type inactivated virus and reverse transcribe it into cDNA.
[0127] 5. Using the cDNA obtained in step 4 as a template, a primer pa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
