Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof

A technology for vesicular stomatitis and foot-and-mouth disease virus, which is applied to the primer combination and application field for identifying foot-and-mouth disease virus and vesicular stomatitis virus, and can solve the problems that there are no research reports on double RT-LAMP detection technology

Active Publication Date: 2016-06-15
GUANGXI VETERINARY RES INST
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no research report on dual RT-LAMP detection technology in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof
  • Primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof
  • Primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0094] Embodiment 1, design and preparation of primer combinations

[0095] A large number of sequence analyzes and comparisons were carried out to obtain several primer sets for identifying FMDV and several primer sets for identifying VSV. Preliminary experiments were performed on each primer set to compare performances such as sensitivity and specificity, and finally a primer set for identifying FMDV and a primer set for identifying VSV were obtained.

[0096] The primer set used to identify FMDV consists of the following four primers (5'→3'):

[0097] FMDV-F3 (Sequence 1): GAACAACATCCACGTGCTCTAC;

[0098] FMDV-B3 (SEQ ID NO: 2): GGCGTGCAAAGGAGAGGATA;

[0099] FMDV-FIP (Sequence 3): ACGATGTCGTCTCCGTAGGAG- gaattc- TAGACACTATGAGGGAGTTGAGCT;

[0100] FMDV-BIP (Sequence 4): CTGACAAAAGCGACAAAGGTT- gaattc-ACAGGTTTGTAAAACCCAGTTCC.

[0101] The primer set used to identify VSV consists of the following four primers (5'→3'):

[0102] VSV-F3 (SEQ ID NO: 5): GAACTGAAGACAGCACTTC...

Embodiment 2

[0109] Embodiment 2, specificity

[0110] 1. Extract the total RNA of the sample to be tested. The samples to be tested are: VSVNJ type inactivated virus, FMDVO type inactivated virus, equal mixture of FMDVO type inactivated virus and VSVNJ type inactivated virus (referred to as mixed virus), BTV4 type inactivated virus, PPRV vaccine strain, BVDV , BRV or IBRV.

[0111] 2. Take the total RNA obtained in step 1 as a template, and use the primer combination in Example 1 to perform RT-LAMP amplification.

[0112] RT-LAMP amplification reaction system (25μL): 1μL template (including RNA10-100ng), 2.5μL 10×buffer, 15UBstDNA polymerase, 20UAMV reverse transcriptase, 40pmolFMDV-FIP, 40pmolFMDV-BIP, 40pmolVSV-FIP, 40pmolVSV-BIP , 5pmolFMDV-F3, 5pmolFMDV-B3, 5pmolVSV-B3, 5pmolVSV-F3, make up the insufficient volume with water. Set up a blank control in which an equal volume of water is used instead of the template.

[0113] Reaction conditions for RT-LAMP amplification: first react...

Embodiment 3

[0121] Embodiment 3, sensitivity

[0122] 1. Preparation of RNA Standards

[0123] 1. Extract the total RNA of FMDVO type inactivated virus and reverse transcribe it into cDNA.

[0124] 2. Using the cDNA obtained in step 1 as a template, a primer pair consisting of FMDV-B3 and FMDV-F3 is used for PCR amplification to obtain a PCR amplification product. After sequencing, the PCR amplification product is shown as sequence 9 in the sequence listing.

[0125] 3. Using the T7 in vitro transcription kit (Fermentas) and operating according to the instructions, the PCR amplification product obtained in step 2 was transcribed in vitro to obtain RNA A, and passed D 260 Determine the RNA concentration, convert the concentration to copy number according to Avogadro constant, and store at -70°C for later use.

[0126] 4. Extract the total RNA of the VSVNJ type inactivated virus and reverse transcribe it into cDNA.

[0127] 5. Using the cDNA obtained in step 4 as a template, a primer pa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer combination for identifying foot-and-mouth disease virus and vesicular stomatitis virus and application thereof. The primer combination is composed of a primer set I and a primer set II. The primer set I is composed of primers FMDV-F3, FMDV-B3, FMDV-FIP and FMDV-BIP which are sequentially disclosed as Sequence 1-4. The primer set II is composed of primers VSV-F3, VSV-B3, VSV-FIP and VSV-BIP which are sequentially disclosed as Sequence 5-8. The invention also discloses application of the primer combination in identifying foot-and-mouth disease virus and vesicular stomatitis virus, application in identifying whether a virus to be detected is foot-and-mouth disease virus or vesicular stomatitis virus, and application in identifying whether a sample to be detected is infected by foot-and-mouth disease virus and / or vesicular stomatitis virus. The duplex RT-LAMP (reverse transcription-loop-mediated isothermal amplification) method established by the invention is a simple quick low-cost diagnosis method, can be used for grass-root and field quarantine inspection under poor conditions, and is also suitable for large-scale epidemiological survey.

Description

technical field [0001] The invention relates to a combination of primers for identifying foot-and-mouth disease virus and vesicular stomatitis virus and its application. Background technique [0002] Foot-and-mouth disease and vesicular stomatitis are highly acute viral infectious diseases of cattle. They are generally explosive and cause huge economic losses to the trade of livestock products and the cattle industry. They are listed as Class A infectious diseases by the World Organization for Animal Health (OIE). Foot-and-mouth disease is caused by foot-and-mouth disease virus (FMDV). Vesicular stomatitis is caused by vesicular stomatitis virus (VSV). FMDV and VSV often have mixed infections clinically, both of which are manifested as restlessness, elevated body temperature, blisters and ulcers in the oral cavity, nipples, and hooves. The clinical symptoms are very similar and difficult to distinguish. Therefore, it is urgent to establish a rapid differential detection te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6844C12Q1/701C12Q1/705C12Q2600/16C12Q2531/119C12Q2537/143C12Q2521/107C12Q2537/1376
Inventor 谢芝勋范晴刘加波庞耀珊邓显文谢志勤谢丽基
Owner GUANGXI VETERINARY RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More