Unlock instant, AI-driven research and patent intelligence for your innovation.

Hereditary spastic paraplegia gene diagnosis chip

A genetic diagnosis and genetic technology, applied in the field of genetic diagnosis chips, can solve the problems of large manpower and material resources, consumption, difficulty in genetic testing, etc., and achieve the effects of low cost, reduced missed detection, and rapid screening

Inactive Publication Date: 2013-01-02
XIANGYA HOSPITAL CENT SOUTH UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Due to the high clinical and genetic heterogeneity of hereditary spastic paraplegia, genetic testing brings great difficulties and requires considerable manpower and material resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hereditary spastic paraplegia gene diagnosis chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0015] The hereditary spastic paraplegia gene diagnosis chip of the present invention has a total of 96 mutation point sequences, including 44 AD-HSPs, 36 AR-HSPs, and 16 X-linked-HSPs, of which SPG3A 7, SPG4 20, SPG6 1, SPG 8 1, SPG10 5, SPG31 4, SPG42 1, SPG5 5, SPG7 6, SPG11 21, SPG15 4, SPG17 5, SPG1 12, SPG2 4.

[0016] Hereditary spastic paraplegia gene diagnostic chip of the present invention is fixed on the optical fiber microbead and can hybridize with the probe of mutation point, and the sequence table of described probe is:

[0017] Numbering sequence 1 gtggtaactaacctggaagtgctgacaagcaaatgcctccatgggaagaactactgtcgayaggtcctctgtctgtatgatcttgccaaggtatgtgccaaggggtggggctcctctttct 2 gtaatttttttcaaactctttgtcaaaggattccccgttactactggtgatggagatgtawgaactgtgtatgttcttcaggaattataaagaagctgaagctaaacttctggagtttcag 3 ttagaacttaacagccttccatccaaagagacatgcgagaatagattggattggaaagagyaggagtcactaaactttttgattgggcgcctactggatgatg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a hereditary spastic paraplegia gene diagnosis chip, totally comprising 96 catastrophe point sequences, wherein the 96 catastrophe point sequences comprise 44 AD-HSP (Autosomal Dominant Hereditary Spastic Paraplegia), 36 AR-HSP (Autosomal Recessive Hereditary Spastic Paraplegia), 16 X-linked-HSP; 7 SPG3A, 20 SPG4, 1 SPG6, 1 SPG8, 5 SPG10, 14 SPG3, 1 SPG42, 5 SPG5, 6 SPG7, 21 SPG11, 4 SPG15, 5 SPG17, 12 SPG1 and 4 SPG2 are contained. The detection steps are as follows: manufacturing a SUD plate; depositing the SUD plate; heavily hoisting the SUD plate; manufacturing an ASE plate; adding MEL; carrying out PCR (Polymerase Chain Reaction) early-stage work; combining PCR products; preparing an early chip sample; hybridizing chips; cleaning chips; scanning chips; readingdata; and analyzing data. The hereditary spastic paraplegia gene diagnosis chip has the advantage of low cost, and can quickly and conveniently screen.

Description

technical field [0001] The invention relates to a gene diagnosis chip, in particular to a gene diagnosis chip for hereditary spastic paraplegia. Background technique [0002] Hereditary spastic paraplegia (HSP or SPG), also known as familial Strümpell-Lorrain spastic paraplegia, is a type of hereditary neurodegenerative disease mainly caused by corticospinal tract damage, with obvious clinical and genetic heterogeneity. HSP can be inherited as autosomal dominant hereditary spastic paraplegia (AD-HSP), autosomal recessive hereditary spastic paraplegia (AR-HSP), X-linked hereditary spastic paraplegia (X-linked hereditary spastic paraplegia, X- linked HSP), some cases were sporadic. [0003] Studies have shown that hereditary spastic paraplegia is a disease caused by pathological mutations of a single gene. This is a group of genetically heterogeneous diseases that can be caused by different mutations in different genes. Therefore, finding and identifying the pathogenic gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C40B40/06
Inventor 沈璐罗莹莹杜鹃
Owner XIANGYA HOSPITAL CENT SOUTH UNIV