Hereditary spastic paraplegia gene diagnosis chip
A genetic diagnosis and genetic technology, applied in the field of genetic diagnosis chips, can solve the problems of large manpower and material resources, consumption, difficulty in genetic testing, etc., and achieve the effects of low cost, reduced missed detection, and rapid screening
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0015] The hereditary spastic paraplegia gene diagnosis chip of the present invention has a total of 96 mutation point sequences, including 44 AD-HSPs, 36 AR-HSPs, and 16 X-linked-HSPs, of which SPG3A 7, SPG4 20, SPG6 1, SPG 8 1, SPG10 5, SPG31 4, SPG42 1, SPG5 5, SPG7 6, SPG11 21, SPG15 4, SPG17 5, SPG1 12, SPG2 4.
[0016] Hereditary spastic paraplegia gene diagnostic chip of the present invention is fixed on the optical fiber microbead and can hybridize with the probe of mutation point, and the sequence table of described probe is:
[0017] Numbering sequence 1 gtggtaactaacctggaagtgctgacaagcaaatgcctccatgggaagaactactgtcgayaggtcctctgtctgtatgatcttgccaaggtatgtgccaaggggtggggctcctctttct 2 gtaatttttttcaaactctttgtcaaaggattccccgttactactggtgatggagatgtawgaactgtgtatgttcttcaggaattataaagaagctgaagctaaacttctggagtttcag 3 ttagaacttaacagccttccatccaaagagacatgcgagaatagattggattggaaagagyaggagtcactaaactttttgattgggcgcctactggatgatg...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 