Screening and identification of genetically engineered Bacillus thuringiensis YBT-881-L1 of overexpressed CodY protein
A technology of YBT-881-L1, genetically engineered bacteria, applied in genetic engineering, plant genetic improvement, bacteria, etc., can solve the problem that the original strain only kills cotton bollworms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0082] Embodiment 1, construction of overexpression vector
[0083] Using the pLip plasmid (the nucleotide sequence of which is described in SEQ ID NO: 5) donated by Professor Yeon-Ho Je's laboratory at Seoul National University as a template, a pair of specific primers, XbaIlipPro5' (TCCTCTAGAGATCTTCTCAAAAAATACTACC) and BamHIlipPro3' (TTCGGATCC TTAGGTGGCACAAATGTGAG ) for PCR amplification. PCR conditions are shown in Table 1.
[0084] Table 1 PCR amplification conditions
[0085]
[0086] After mixing, place the reaction on a PCR machine. The cycle program was denaturation at 95°C for 5min; followed by 94°C for 40s, annealing at 56°C, 72°C for 1-2min, 30 cycles; and finally extension at 72°C for 8min.
[0087] The obtained 272bp product (its sequence is shown in SEQ ID NO: 5) was digested with XbaI / BamHI double enzymes, and then cloned into the pBS KS(+) vector digested with the same enzyme (gifted by Professor He Jing, School of Life Science and Technology, Huazhong Ag...
Embodiment 2
[0093] Example 2, Construction of Overexpression Recombinant Bacteria of Transcription Regulator CodY in Bacillus thuringiensis YBT-881
[0094] Pick a single colony of Bacillus thuringiensis YBT-881 into 5mL liquid LB culture solution, and culture it on a shaking table at 30°C for 8h. After pre-cooling the cells on ice, pour them into a sterile centrifuge tube, centrifuge at 10,000r / min for 10 minutes, discard the supernatant, resuspend the pellet with ice-cold DDW, recover by centrifugation, repeat washing three times, and finally resuspend in 1mL 40% PEG 6000 (w / v). In this way, Bacillus thuringiensis YBT-881 competent cells were prepared. In a pre-cooled transformation cup (2 mm), add 300 uL of the above-mentioned competent cells, and then add 2-5 μg of recombinant DNA plasmid, mix well and let stand on ice for 10 minutes. The electric shock condition is: 2.3kV, 475Ohm, 25μF. Add 3mL LB as soon as possible after the electric shock, transfer to a sterile bottle at 30°C t...
Embodiment 3
[0100] Example 3. The relevant solutions used for the extraction of the original Bacillus thuringiensis YBT-881 and the overexpression strain Bacillus thuringiensis YBT-881-L1 are as follows:
[0101] STE solution formulation (1 L): 0.1 mmol NaCl, 10 mmol Tris-HCl, 50 mmol EDTA.
[0102] Solution I formulation (1L): 25mM Tris-HCl (pH8.0), 10mM EDTA, 50mM Glucose.
[0103] Solution II formulation (1 L): 200 mM NaOH, 1% sodium dodecyl sulfate (SDS).
[0104] Solution III formulation (1 L): 3M KOAc, 5M CH3COOH.
[0105] (1) The original Bacillus thuringiensis YBT-881 and the overexpression strain YBT-881-L1 were respectively inoculated into fresh LB solid medium, and cultured overnight at 28°C.
[0106] (2) Pick a small amount of bacterial cells and inoculate them in 5 mL LB liquid medium, and cultivate them to the logarithmic phase with shaking at 28°C.
[0107] (3) The cells were collected by centrifugation and washed once with STE. Suspend the bacteria in 200 μL solution I...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More