Supercharge Your Innovation With Domain-Expert AI Agents!

Mycoplasma pneumonia detection kit

A detection kit and technology for Mycoplasma pneumoniae, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of inability to achieve rapid diagnosis, cumbersome operation, and low efficiency, and achieve high accuracy and simple operation , the effect of high sensitivity

Inactive Publication Date: 2013-09-04
BEIJING FRIENDSHIP HOSPITAL CAPITAL MEDICAL UNIV
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the isolation and culture method is the gold standard, it requires special laboratory equipment and personnel, and takes a long time, taking more than a week. It also takes time for the antibody level to rise in serum antibody detection. Neither of these two methods can achieve early rapid diagnosis
Nested PCR (nested PCR) technology is one of the most commonly used detection methods for Mycoplasma pneumoniae in recent years. Although it has high sensitivity and specificity, it also has disadvantages such as cumbersome operation and low efficiency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycoplasma pneumonia detection kit
  • Mycoplasma pneumonia detection kit
  • Mycoplasma pneumonia detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1. Preparation and verification of Mycoplasma pneumoniae detection kit

[0024] 1. Extract the total DNA of the sample using a commercial DNA extraction kit.

[0025] 2. Using the Mycoplasma pneumoniae specific gene sequence SDC1 sequence (GenBank accession No. M35024) as a template, design outer primers (F3 and B3), inner primers (FIP and BIP), and design a circular primer to accelerate the amplification reaction. The primer sequences are as follows:

[0026] Outer primer F3:

[0027] 5'TTGGTGGAAAACACGGCC3' (as shown in SEQ ID NO.1);

[0028] Outer primer B3:

[0029] 5'GTTGAGTGGGCTGGCATTA3' (as shown in SEQ ID NO.2);

[0030] Inner primer FIP:

[0031] 5'CCTTTCATCCCACTCACGGGGATGGCTTGTTTACCCTGCTC3' (shown in SEQ ID NO.3);

[0032] Inner primer BIP:

[0033] 5'AAGTGCAAACGACTTACCCGGTTAAGGAGGCAATTTTGGCGG3' (shown in SEQ ID NO.4);

[0034] Loop primer LOOP:

[0035] 5'CAAGTCCGACCAAAAGGCC3' (shown in SEQ ID NO. 5).

[0036] Reaction system for constant tem...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mycoplasma pneumonia detection kit. The mycoplasma pneumonia detection kit comprises outer primers F3 and B3 designed through loop-mediated isothermal amplification (LAMP) technology, inner primers FIP and BIP and a loop primer, wherein the sequences of the outer primers F3 and B3, the inner primers FIP and BIP and the loop primer are respectively shown as SEQ ID NO.1-SEQ ID NO.5. The primers adopted by the kit are good in specificity, high in accuracy and high in sensitivity; and the kit is simple to operate, can be used for fast detecting mycoplasma pneumoniae pneumonia, and provides guarantee for the clinical early-stage diagnosis and treatment.

Description

technical field [0001] The invention relates to a detection kit, in particular to a detection kit for Mycoplasma pneumoniae designed based on a loop-mediated isothermal amplification technique. Background technique [0002] Mycoplasma pneumoniae has increasingly become the main infectious pathogen of community-acquired pneumonia, accounting for about 30-40% of the pathogenic pathogens, and it can even reach 60% in outbreaks. If the diagnosis of Mycoplasma pneumoniae pneumonia is confirmed, macrolide antibiotics need to be given, so it is particularly important to make a definite diagnosis at the early stage of infection. [0003] At present, in addition to clinical symptoms such as cough and fever, chest X-ray, peripheral blood and CRP detection, the detection and diagnosis methods of Mycoplasma pneumoniae infection mainly include isolation and culture from respiratory samples, serum antibody titer detection and other methods. Although the isolation and culture method is th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 辛德利李丹董艳青
Owner BEIJING FRIENDSHIP HOSPITAL CAPITAL MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More