Recombinant plasmid pfastdual-polh-da26-asp, Bombyx mori baculovirus and method for producing l-asparaginase Ⅱ using the virus
A pfastdual-polh-da26-asp, da26-asp technology, applied in the field of genetic engineering, can solve the problems of low fermentation level and numerous separation and purification steps, and achieve high activity, simplified separation and purification process, and good safety effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0031] This specific embodiment is only an explanation of the present invention, and it is not a limitation of the present invention. Those skilled in the art can make modifications to this embodiment without creative contribution as required after reading this specification, but as long as they are within the rights of the present invention All claims are protected by patent law.
[0032] 1. Primer Design
[0033] amplify da26
[0034] Primers were designed as follows:
[0035] Upstream primer da26-F: TCC CCCGGG ATGAATTCTGTTCACACG (underlined Sma Ⅰ restriction site) SEQ ID No.1;
[0036] Downstream primer da26-R: GC TCTAGA GCAATAGGCGTTAATATCACTTTG (underlined Xba Ⅰ restriction site) SEQ ID No.2.
[0037] Amplification of Escherichia coli L-asparaginase Ⅱ Gene Mature Region Fragment
[0038] The primers were designed as follows
[0039] Upstream primer asp-F: GC TCTAGA GCCCATCACCATCACCATCAC (underlined Xba Ⅰ restriction site) SEQ ID No.3;
[0040] Downstream ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More