Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant plasmid pfastdual-polh-da26-asp, Bombyx mori baculovirus and method for producing l-asparaginase Ⅱ using the virus

A pfastdual-polh-da26-asp, da26-asp technology, applied in the field of genetic engineering, can solve the problems of low fermentation level and numerous separation and purification steps, and achieve high activity, simplified separation and purification process, and good safety effects

Inactive Publication Date: 2015-10-21
HUZHOU ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the production of L-asparaginase Ⅱ mostly adopts genetically engineered bacteria with Escherichia coli as the host, and there are two problems in the production: low fermentation level and many separation and purification steps.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] This specific embodiment is only an explanation of the present invention, and it is not a limitation of the present invention. Those skilled in the art can make modifications to this embodiment without creative contribution as required after reading this specification, but as long as they are within the rights of the present invention All claims are protected by patent law.

[0032] 1. Primer Design

[0033] amplify da26

[0034] Primers were designed as follows:

[0035] Upstream primer da26-F: TCC CCCGGG ATGAATTCTGTTCACACG (underlined Sma Ⅰ restriction site) SEQ ID No.1;

[0036] Downstream primer da26-R: GC TCTAGA GCAATAGGCGTTAATATCACTTTG (underlined Xba Ⅰ restriction site) SEQ ID No.2.

[0037] Amplification of Escherichia coli L-asparaginase Ⅱ Gene Mature Region Fragment

[0038] The primers were designed as follows

[0039] Upstream primer asp-F: GC TCTAGA GCCCATCACCATCACCATCAC (underlined Xba Ⅰ restriction site) SEQ ID No.3;

[0040] Downstream ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for the fusion expression of escherichia coli asparaginase in a bombyx mori cell and a bombyx mori body by utilizing a rhabdovirus recombination system. The method comprises the following steps: constructing da26 and Asp into a fusion gene through nucleotide connection in a same enzyme cutting site, cloning the fusion gene into a pFastdual carrier containing double promoters, meanwhile cloning polh to a polyhedrosis promoter to form a new recombinant plasmid, through homologous recombination of transfer vectors, forming recombined Bacmid of fusion expression containing da26 and Asp, and obtaining the recombined virus after transfection of the bombyx mori cell. BV / ODV-E26 expressed by da26 is an envelope protein from BmNPV, can cohesively combined with the protein expressed by exogenous gene, and can separate and purify exogenous protein through ultraphonic pyrolysis and differential centrifugation methods. The expression system not only can acquire more Asp, but also can acquire fusion expression product da26-Asp through the centrifugal purification of polynedron as the BV / ODV-E26 can be attached to the surface of the polynedron particle formed by BmNPV, then can elute fusion protein through elution, and simplifies the purification process.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for expressing Escherichia coli asparaginase in silkworm cells and silkworm bodies by using a baculovirus recombination system. Background technique [0002] L-Asparaginase Ⅱ ( L-Asparaginase Ⅱ , EC 3.5.1.1) is L-tianamide amidohydrolase, which can specifically catalyze the hydrolysis of L-asparagine to generate L-aspartic acid and ammonia. It is an important protein anti-tumor drug. It is widely used clinically in the treatment of lymphoma and childhood acute lymphoblastic leukemia (ALL), and can also be used in the treatment of melanosarcoma, Hodgkinson's disease, pancreatic cancer and other diseases. [0003] At present, the production of L-asparaginase Ⅱ mostly adopts genetically engineered bacteria with Escherichia coli as the host, and there are two problems in the production: low fermentation level and many separation and purification steps. [0004]...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N15/66C12N7/01C12N9/82C12R1/93
Inventor 费建明王文兵占鹏飞吴岩施国方
Owner HUZHOU ACAD OF AGRI SCI