A kind of lentiviral vector (lentiviral Vector) expressing the whole gene of human antibody and its method
A technology of lentiviral vector and shuttle expression vector, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problems of low cutting efficiency, unclear cutting regulation mechanism, low efficiency and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Construction steps of various expression schemes for expression of 2G12 whole gene by pLVX vector
[0041] 1. Construction of plasmid 2G12-pLVX / cLcH
[0042] (1) Insert the linker at the multiple cloning site of the vector pLVX (i.e. pLVX-pu ro plasmid, Clontech Company, Cat.No.632160):
[0043] In order to facilitate the insertion of IgG light chain (L) and heavy chain (H) into the vector, LinkerEB containing EcoRI-NotⅠ-BamHI was designed, and its two ends have sticky ends with EcoRI and BamHI restriction sites, which were connected to the vector pLVX
[0044] Linked as pLVX / linkerEB. The primers designed by linkerEB are as follows:
[0045] LinkerEB-F: 5′…aattcataagaatgcggccgcg…3′
[0046] LinkerEB-R: 5′…gatccgcggccgcattcttatg…3′
[0047] (2) PCR amplification of WPRE (template source: pLVX-puro plasmid) (NotⅠ, PstⅠ), 2G12-L (template source: 2G12-PBR322based IG-H plasmid, constructed by our unit) (EcoRI, NotⅠ), 2G12-H (Template source: 2G12-PBR322base...
Embodiment 2
[0105] Example 2: Method for Quantitative Determination of Human IgG Content by Double Antibody Sandwich ELISA
[0106] (1) Coating: Coat with Goat anti human kappa, UNLB (Company: Southern Biotech, Cat. No.: 2070-01), 50ng / well, overnight at 4°C, wash three times with PBST, do not coat 2x2 blank control wells in the lower right corner.
[0107] (2) Blocking: Block with 5% skimmed milk powder, 100 μl / well, block for 1 hour at 37°C, and wash three times with PBST.
[0108] ⑶ Add standards and samples to be tested:
[0109] Add the IgG standard (Invitrogen, lot1069920A, TEF027102) and the sample to be tested on the same ELISA plate. The standard is serially diluted with 0.1 μg / ml from the first well for 8 serial dilutions, and two duplicate holes are made. ; Samples to be tested (including cell expression supernatant, mouse serum, etc.) were serially diluted in 8 dilution wells at a certain dilution, and two duplicate wells were made, incubated at 37°C for 1 hour, and washed th...
Embodiment 3
[0115] Example 3: Expression of 2G12 at the cellular level using 6 double-gene construction schemes
[0116] The extracted high-purity plasmids of six construction schemes (pLVX / cLcH, pLVX / cLmH, pLVX / cLhH, pLVX / cLeH, pLVX / cHcL, pLVX / eLcH) were transiently transfected into 293T cells, and FuGENE HD transfection reagent ( Roche Company, Cat.No.04709705001) transfection, the specific operation was carried out according to the instructions of FuGENE HD, and the human IgG content was measured by the double antibody sandwich ELISA method (see Example 2 for the method) to detect the human IgG content in the supernatant of cells transfected for 72 hours . The results are shown in Table 2. By comparing the expression of the six construction schemes, it was found that pLVX / cLcH is the best scheme for high-efficiency expression of the whole gene of the human antibody.
[0117] The expression levels of 6 kinds of plasmids transiently transfected into 293T cells constructed in table 22G12...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 