Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of lentiviral vector (lentiviral Vector) expressing the whole gene of human antibody and its method

A technology of lentiviral vector and shuttle expression vector, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problems of low cutting efficiency, unclear cutting regulation mechanism, low efficiency and so on

Inactive Publication Date: 2015-08-12
BEIJING UNIV OF TECH +3
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This construction scheme can avoid mutual interference during double promoter transcription, but the efficiency of gene expression in the downstream of the IRES is much lower than that of the upstream gene expression; (3) The fusion expression construction strategy uses a linker to link the two Two genes are connected, and a bifunctional fusion protein molecule is translated under the control of a promoter, but for antibodies, the light and heavy chains need to be expressed separately to assemble into a functional and three-dimensional structure of complete IgG
In addition, there are donor / acceptor site cleavage construction strategies, Furin cleavage construction strategies, 2A sequence self-cleavage construction strategies, etc. Due to the low in vivo cleavage efficiency of these construction strategies, the expression efficiency of the two genes is also very unstable. , and the regulatory mechanism of partial shearing is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of lentiviral vector (lentiviral Vector) expressing the whole gene of human antibody and its method
  • A kind of lentiviral vector (lentiviral Vector) expressing the whole gene of human antibody and its method
  • A kind of lentiviral vector (lentiviral Vector) expressing the whole gene of human antibody and its method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Construction steps of various expression schemes for expression of 2G12 whole gene by pLVX vector

[0041] 1. Construction of plasmid 2G12-pLVX / cLcH

[0042] (1) Insert the linker at the multiple cloning site of the vector pLVX (i.e. pLVX-pu ro plasmid, Clontech Company, Cat.No.632160):

[0043] In order to facilitate the insertion of IgG light chain (L) and heavy chain (H) into the vector, LinkerEB containing EcoRI-NotⅠ-BamHI was designed, and its two ends have sticky ends with EcoRI and BamHI restriction sites, which were connected to the vector pLVX

[0044] Linked as pLVX / linkerEB. The primers designed by linkerEB are as follows:

[0045] LinkerEB-F: 5′…aattcataagaatgcggccgcg…3′

[0046] LinkerEB-R: 5′…gatccgcggccgcattcttatg…3′

[0047] (2) PCR amplification of WPRE (template source: pLVX-puro plasmid) (NotⅠ, PstⅠ), 2G12-L (template source: 2G12-PBR322based IG-H plasmid, constructed by our unit) (EcoRI, NotⅠ), 2G12-H (Template source: 2G12-PBR322base...

Embodiment 2

[0105] Example 2: Method for Quantitative Determination of Human IgG Content by Double Antibody Sandwich ELISA

[0106] (1) Coating: Coat with Goat anti human kappa, UNLB (Company: Southern Biotech, Cat. No.: 2070-01), 50ng / well, overnight at 4°C, wash three times with PBST, do not coat 2x2 blank control wells in the lower right corner.

[0107] (2) Blocking: Block with 5% skimmed milk powder, 100 μl / well, block for 1 hour at 37°C, and wash three times with PBST.

[0108] ⑶ Add standards and samples to be tested:

[0109] Add the IgG standard (Invitrogen, lot1069920A, TEF027102) and the sample to be tested on the same ELISA plate. The standard is serially diluted with 0.1 μg / ml from the first well for 8 serial dilutions, and two duplicate holes are made. ; Samples to be tested (including cell expression supernatant, mouse serum, etc.) were serially diluted in 8 dilution wells at a certain dilution, and two duplicate wells were made, incubated at 37°C for 1 hour, and washed th...

Embodiment 3

[0115] Example 3: Expression of 2G12 at the cellular level using 6 double-gene construction schemes

[0116] The extracted high-purity plasmids of six construction schemes (pLVX / cLcH, pLVX / cLmH, pLVX / cLhH, pLVX / cLeH, pLVX / cHcL, pLVX / eLcH) were transiently transfected into 293T cells, and FuGENE HD transfection reagent ( Roche Company, Cat.No.04709705001) transfection, the specific operation was carried out according to the instructions of FuGENE HD, and the human IgG content was measured by the double antibody sandwich ELISA method (see Example 2 for the method) to detect the human IgG content in the supernatant of cells transfected for 72 hours . The results are shown in Table 2. By comparing the expression of the six construction schemes, it was found that pLVX / cLcH is the best scheme for high-efficiency expression of the whole gene of the human antibody.

[0117] The expression levels of 6 kinds of plasmids transiently transfected into 293T cells constructed in table 22G12...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a lentiviral vector for gene therapy, cancer therapy, preparation of recombinant proteins such as antibodies and vaccines, and other treatment items. The invention provides a method for establishing a high-efficiency double-genetic expression system with a human antibody heavy chain and light chain whole-gene by using a lentiviral vector system, and in particular discloses a method for establishing a lentiviral vector expression system for efficiently expressing human antibody whole-gene by using a lentiviral shuttling expression vector pLVX. The expression system not only has a good antibody expression effect on cell level, but also has high expression inside mammal bodies within a short time, and can be widely applied to the field of biologic pharmacy.

Description

technical field [0001] The present invention relates to the fields of molecular medicine and gene therapy. Specifically, a lentiviral vector expression system for efficiently expressing the entire human antibody gene is constructed by using the lentiviral shuttle expression vector pLVX. The specific application is not limited to the vectors and antibody gene. This expression system not only has a good effect of expressing antibodies at the cellular level, but also has a high expression in mammals in a short period of time. The present invention is a lentiviral vector expressing the whole gene of antibodies in antibody therapy, tumor therapy, stem cell therapy and novel The research on the expression of antibody vaccines in vivo provides an important basis, and also provides a new direction for the research of new neutralizing antibody gene vaccines in my country. Background technique [0002] Antibody (Antibody) refers to the immunoglobulin produced by the immune system of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N15/66
Inventor 曾毅贾润清管永军余双庆周玉梅冯霞
Owner BEIJING UNIV OF TECH