Botryococcus braunii and application thereof

A technology of botrytis branii and algae strains, which is applied in the field of microbial engineering, can solve the problems of slow growth of botrytis, low total hydrocarbon content, and limited application, and achieve the effects of high hydrocarbon content, fast growth speed, and high biomass

Active Publication Date: 2014-02-12
ENN SCI & TECH DEV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Botrytis in the prior art has disadvantages such as slow growth rate, low biomass, and low total hydrocarbon content, which limits its application in industrialization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Botryococcus braunii and application thereof
  • Botryococcus braunii and application thereof
  • Botryococcus braunii and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Algae Strain Isolation, Purification, Screening

[0040] Method 1: Add 1 / 3 volume of BG11 medium (recipe in Table 1) to the pond water sample retrieved from Hainan area and culture it for about one month, draw 20-100 μL of water sample and drop it on the glass slide, use 40 times Or 100 times microscope observation, move the botrytis algae cells into the middle of the field of view, use a glass capillary tube with an inner diameter of 0.9-1.1 mm to burn through the outer flame of an alcohol lamp for 1-5 seconds, and then stretch it rapidly, and pull the capillary diameter to about 100 μm. Take algae cells directly under the microscope, inoculate them in 48-well culture plates filled with BG11 medium (recipe in Table 1), at 25°C, light intensity 50μmol / m 2 ·Cultivate for about 3 weeks under the condition of s, observe under the microscope, select the wells with only a single algae strain, and spread or streak the plate to obtain a single algae strain.

[0041]...

Embodiment 2

[0047] Example 2 Classification and Identification

[0048] (1) Shape identification

[0049] Observed under the microscope, the shape of ENN41 algal cells is oval or wedge-shaped, and they are clustered in clusters; cell size: 6 μm to 8 μm in length, 5 μm to 7 μm in width, and the aggregate size is more than 50 μm; the color of the cells is black green or yellowish brown; the cell package Enclosed in irregularly branched or leafed, translucent gelatinous colonies; cell division often forms two spore-like spores, and colonies often break into smaller colonies. The strain was initially identified as Botryococcus braunii.

[0050] Microscopic examination pictures such as figure 2 shown.

[0051] (2) Molecular identification:

[0052] 18S sequence amplification uses eukaryotic 18S amplification universal primers (primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.).

[0053] Primer 15'CCTGGTTGATCCTGCCAG 3'

[0054] Primer 25'TTGATCCTTCTGCAGGTTCA 3'

[005...

Embodiment 3

[0072] The growth situation of embodiment 3 in 3cm column reactor

[0073] Inoculate the ENN41 algae strain in the logarithmic growth phase in the prepared BG11 medium (see Table 1 for the formula) to make the cell density reach OD 750 is 0.3. The reactor used for the cultivation was a column reactor with an inner diameter of 30 mm and a length of 600 mm. The light intensity is gradually increased according to the cell state and density, and the light intensity is controlled at 50-500 μmol / m during the culture process 2 ·s. 24 hours of light, during the culture period, the pH value of the culture medium is adjusted between 7 and 9 by feeding a mixed gas of 1.5 to 2% carbon dioxide and air into the culture solution. The temperature is controlled within the range of 20-35°C. During the cultivation process, samples were taken regularly to determine the dry weight, and the results were shown in Figure 5 . The ENN41 algae strain was cultured in the general-purpose BG11 mediu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
The inside diameter ofaaaaaaaaaa
Dry weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses botryococcus braunii ENN41 with collection number CGMCC No.5149. The botryococcus braunii ENN41 disclosed by the invention has the advantages of high biomass, high hydrocarbon content, high growth rate and high culture density, and is suitable for industrialization application. The invention also discloses an application of the botryococcus braunii ENN41 to biofuels and particularly to biological hydrocarbon, biological diesel or biological kerosene, an application to wastewater treatment, waste gas treatment and CO2 emission reduction, and an application to the production of pigment and animal feed.

Description

technical field [0001] The present invention relates to the field of microbial engineering, in particular, the present invention relates to a botrytis brachyphylla and its application. Background technique [0002] With the shortage of global fossil energy and the environmental problems it brings, it is imperative to find new alternative energy sources. Microalgae have the characteristics of large biomass, short growth cycle and high oil content. 2 Both emission reduction and biofuel utilization have broad development prospects. [0003] At present, there are two main R&D ideas for using microalgae to produce biodiesel. One is to use fatty acid synthesized by microalgae to produce biofuel through esterification. Because most microalgae can accumulate a large amount of oil through fatty acid synthesis, the current development of microalgae energy Most of the research uses this kind of research and development ideas to develop microalgae biofuels; the other is to use the hydr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/12C12P5/00C12P7/64C02F3/32B01D53/84C12P23/00A23K1/16C12R1/89
CPCY02E50/13Y02A50/20Y02E50/10Y02P20/59
Inventor陈传红吴洪尹顺吉马建源
OwnerENN SCI & TECH DEV