Method for detecting 5-methylcystein in DNA

A technology of methylcytosine and cytosine, applied in the field of nucleic acid analysis, can solve problems such as ineffective reflection

Inactive Publication Date: 2014-05-14
WUHAN UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, they all have their own limitations
Restriction endonucleases require specific cleavage sites, so they can only reflect methylation at specific cleavage sites
For methylation-specific PCR, the primers must contain a certain number of CpG islands to ensure the specificity of the primers, so as to effectively recognize methylated and unmethylated template DNA; therefore, this method cannot effectively reflect the Other methylation sites of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting 5-methylcystein in DNA
  • Method for detecting 5-methylcystein in DNA
  • Method for detecting 5-methylcystein in DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Sodium bisulfite treatment of DNA

[0022] Dissolve less than 2 μg of DNA in 50 μl of ultrapure water, add 5.5 μl of freshly prepared NaOH (initial concentration: 3 M), and incubate in a 42° C. water bath for 30 minutes. Prepare 10 mM hydroquinone (hydroquinone) during the water bath. After the 30-minute water bath, add 30 μl to the DNA mixed solution, and the solution turns yellow. Then add 520 μl 3.6M NaHSO 3 , Gently invert the solution to mix well. Finally, add 200 μl of paraffin oil and react in a 50° C. water bath for 16 hours. After the reaction was completed, the mixture was desalted with a pore membrane, and precipitated with ice ethanol at -80°C for 2 hours, dried and dissolved in a certain amount of ultrapure water for UV quantification.

Embodiment 2

[0023] Example 2: Quantitative detection of 5-methylcytosine content by neutral polyacrylamide gel electrophoresis.

[0024] The upstream primer is GGGTTTTATTTATTTTAATTAATATTATATT (SEQ ID No 2), and the downstream primer is TCACCACTTCTCCCCTCAAT (SEQ ID No 3).

[0025] The asymmetric PCR reaction solution contains 1×PCR reaction buffer, 1μl dATP, dTTP and dCTP (initial concentration is 2mM), 0.5μl dGTP (initial concentration is 1mM), 1.5μl Fluorescein-dGTP (initial concentration is 1mM ), and finally ensure that the final concentration of these four bases is the same, which is 200 μM; 2.5U HotstartTaq polymerase, 0.5 μl upstream primer (initial concentration is 1 μM), 5 μl downstream primer (initial concentration is 10 μM) and sodium bisulfite treatment The final DNA template (20ng); the final reaction volume was 20μl. The reaction conditions for asymmetric PCR are: denaturation at 95°C for 15 minutes, followed by 35 amplification cycles (denaturation at 94°C for 30 seconds, a...

Embodiment 3

[0028] Example 3: Detection of the methylation level of the E-cadherin tumor suppressor gene promoter in the genomes of MDA-MB-231 and 97L cells by means of fluorescence.

[0029] Upstream primer TAGTAATTTTAGGTTAGAGGGTTAT (SEQ ID No 4), downstream primer AAACTCACAAATACTTTACAATTCC (SEQ ID No 5).

[0030] Both MDA-MB-231 and 97L cells were cultured in modified-1640 medium containing 10% fetal bovine serum, 1% streptomycin-penicillin, 5% CO 2 cultured in an incubator. Subsequently, the DNA of the two cell lines was extracted with a genomic DNA extraction kit, followed by sodium bisulfite treatment and asymmetric PCR. The conditions of asymmetric PCR are basically the same as in Example 2. 1×PCR reaction buffer, 1μl dATP, dTTP and dCTP (initial concentration is 2mM), 0.5μl dGTP (initial concentration is 1mM), 1.5μl Fluorescein-dGTP (initial concentration is 1mM), 2.5U Hotstart Taq polymerization Enzyme, 0.5 μl upstream primer (initial concentration is 1 μM), 5 μl downstream pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting 5-methylcystein in DNA. The method is used for detecting the 5-methylcystein in the DNA based on an asymmetric PCR (polymerase chain reaction) theory by applying dGTP (deoxyguanosine triphosphate) containing a fluorophore. The method comprises the specific detection steps of treating the DNA containing the 5-methylcystein by a sodium hydrogen sulfite method, converting cytosine in the DNA into uracil, and obtaining complementary chains of a large amount of target DNAs through asymmetric PCR, wherein adenine without fluorescence is complementary to the cytosine in the DNA, and dGTP with fluorescence is compensatory to the 5-methylcystein; detecting 5-methylcystein in the DNA through DNA gel electrophoresis (PAGE). Therefore, the 5-methylcystein in the DNA can be subjected to fluorescence detection through excitation at 492 nanometers.

Description

technical field [0001] The invention relates to a method for detecting 5-methylcytosine in DNA, belonging to the field of nucleic acid analysis. Background technique [0002] Epigenetics is defined as the study of the inheritance of information on gene expression levels (quantitative changes). DNA methylation is the main form of epigenetics. [0003] DNA methylation has a great relationship with tumors. Unlike normal cells, the whole genome DNA in tumor cells is at a low methylation level, which causes chromosome instability and the activation of proto-oncogenes and so on. The inactivation of tumor suppressor genes caused by hypermethylation of some specific genes (such as CpG islands of tumor suppressor gene promoters) is also one of the important reasons for tumorigenesis. Therefore, the detection of promoter CpG island hypermethylation can be used for early detection of tumors; at the same time, the hypermethylation of specific genes can also be used as the basis for t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q2523/125C12Q2531/107C12Q2563/107
Inventor周翔洪婷婷
OwnerWUHAN UNIV