SCAR molecular mark for performing sex identification of siraidia grosvenorii
A molecular marker, Luo Han Guo technology, applied in the direction of DNA/RNA fragment, recombinant DNA technology, microbial determination/inspection, etc., can solve problems such as labor-intensive, difficult to popularize good varieties of Luo Han Guo, occupying fields, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1. RAPD markers of different male and female strains of Luo Han Guo with random primer P7
[0042] In the present invention, the leaves of male and female plants of Luo Han Guo are used as materials to extract genomic DNA, and 10 random primers are used for amplification polymorphism screening. The amplification reaction system and reaction procedures refer to Chen Qijun et al. (Chen Qijun, Han Yuzhen, Fu Yongfu, etc. RAPD and SCAR molecular markers of sex [J]. Acta Physiological Plant, 2001, 27(2): 173-178.) method. The experimental results showed that one of the random primers, P7, amplified a specific fragment of Luo Han Guo male plant. This differential fragment was recovered, cloned and subjected to sequencing analysis to obtain a 1216bp nucleotide sequence, which was named Z-1200, and its nucleotide sequence is shown in SEQ ID NO:2.
[0043] Among them, random primer P7 was used to amplify the genomic DNA of 5 diploid female plants, 4 diploid male plant...
Embodiment 2
[0062] Example 2. Determination of specific SCAR markers of Luo Han Guo male and female strains
[0063] In order to convert RAPD markers into more accurate SCAR markers, the inventors designed a new pair of primers at both ends according to its nucleotide sequence based on the specific fragment Z-1200 (SEQ ID NO: 2) of Luo Han Guo male strains mentioned above to specifically Amplify this fragment. The amplification primers of the Z-1200 are as follows:
[0064] Z1200-F1: 5' AGAAACTAATAATGAATTACCACTG 3' (SEQ ID NO: 3);
[0065] Z1200-R1: 5' CAAGTTTTTGGATATAGTGGTAGTT 3' (SEQ ID NO: 4).
[0066] Using the genomic DNA of 11 different male and female Luo Han Guo plants as templates, the primers Z1200-F1 and Z1200-R1 were used to amplify according to the following PCR amplification system.
[0067] PCR amplification system:
[0068] Water 13.2ul
[0069] 10×buffer 2 ul
[0070] dNTP 0.4ul
[0071] Z1200-F1 0.5ul
[0072] Z1200-R1 0.5ul
[0073] Taq 0.4ul
[0074] DNA 3u...
Embodiment 3
[0083] Example 3. Sex identification of random sampling in the field
[0084] Randomly selected 26 lines that had flowered in the field as identification samples, among which the sample numbers 10, 11, 13, 14, 20, 22, 23, 24, and 25 were male plants, and the rest were female plants. Genomic DNA was extracted and identified with SCAR labeled primers Z1200-F2 and Z120-R2. The specific method was the same as above. The results of PCR electrophoresis were as follows: Figure 5 As shown: the number marked in the figure is the sample number, and the bands numbered 10, 11, 13, 14, 20, 22, 23, 24, and 25 were amplified to a size of 811bp.
[0085] The PCR results are consistent with the actual male and female status. All male plants can amplify the target bands, while the female plants have no amplified products. It is further confirmed that this method can be used to identify the male and female of Luo Han Guo seedlings.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com