SCAR molecular mark for performing sex identification of siraidia grosvenorii

A molecular marker, Luo Han Guo technology, applied in the direction of DNA/RNA fragment, recombinant DNA technology, microbial determination/inspection, etc., can solve problems such as labor-intensive, difficult to popularize good varieties of Luo Han Guo, occupying fields, etc.

Active Publication Date: 2014-10-01
怀化兴科创生物技术有限公司
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition to occupying the field, it is also labor-intensive
It has caused great difficulties for the breeding of Luo Han Guo and the promotion of fine varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SCAR molecular mark for performing sex identification of siraidia grosvenorii
  • SCAR molecular mark for performing sex identification of siraidia grosvenorii
  • SCAR molecular mark for performing sex identification of siraidia grosvenorii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. RAPD markers of different male and female strains of Luo Han Guo with random primer P7

[0042] In the present invention, the leaves of male and female plants of Luo Han Guo are used as materials to extract genomic DNA, and 10 random primers are used for amplification polymorphism screening. The amplification reaction system and reaction procedures refer to Chen Qijun et al. (Chen Qijun, Han Yuzhen, Fu Yongfu, etc. RAPD and SCAR molecular markers of sex [J]. Acta Physiological Plant, 2001, 27(2): 173-178.) method. The experimental results showed that one of the random primers, P7, amplified a specific fragment of Luo Han Guo male plant. This differential fragment was recovered, cloned and subjected to sequencing analysis to obtain a 1216bp nucleotide sequence, which was named Z-1200, and its nucleotide sequence is shown in SEQ ID NO:2.

[0043] Among them, random primer P7 was used to amplify the genomic DNA of 5 diploid female plants, 4 diploid male plant...

Embodiment 2

[0062] Example 2. Determination of specific SCAR markers of Luo Han Guo male and female strains

[0063] In order to convert RAPD markers into more accurate SCAR markers, the inventors designed a new pair of primers at both ends according to its nucleotide sequence based on the specific fragment Z-1200 (SEQ ID NO: 2) of Luo Han Guo male strains mentioned above to specifically Amplify this fragment. The amplification primers of the Z-1200 are as follows:

[0064] Z1200-F1: 5' AGAAACTAATAATGAATTACCACTG 3' (SEQ ID NO: 3);

[0065] Z1200-R1: 5' CAAGTTTTTGGATATAGTGGTAGTT 3' (SEQ ID NO: 4).

[0066] Using the genomic DNA of 11 different male and female Luo Han Guo plants as templates, the primers Z1200-F1 and Z1200-R1 were used to amplify according to the following PCR amplification system.

[0067] PCR amplification system:

[0068] Water 13.2ul

[0069] 10×buffer 2 ul

[0070] dNTP 0.4ul

[0071] Z1200-F1 0.5ul

[0072] Z1200-R1 0.5ul

[0073] Taq 0.4ul

[0074] DNA 3u...

Embodiment 3

[0083] Example 3. Sex identification of random sampling in the field

[0084] Randomly selected 26 lines that had flowered in the field as identification samples, among which the sample numbers 10, 11, 13, 14, 20, 22, 23, 24, and 25 were male plants, and the rest were female plants. Genomic DNA was extracted and identified with SCAR labeled primers Z1200-F2 and Z120-R2. The specific method was the same as above. The results of PCR electrophoresis were as follows: Figure 5 As shown: the number marked in the figure is the sample number, and the bands numbered 10, 11, 13, 14, 20, 22, 23, 24, and 25 were amplified to a size of 811bp.

[0085] The PCR results are consistent with the actual male and female status. All male plants can amplify the target bands, while the female plants have no amplified products. It is further confirmed that this method can be used to identify the male and female of Luo Han Guo seedlings.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of plant molecular biology, and in particular relates to a method for identifying male or female of the siraidia grosvenorii by means of PCR and provides specific DNA segment sequences of male plants of the siraidia grosvenorii, the design of PCR primers, the optimization of PCR conditions and the like.

Description

technical field [0001] The invention belongs to the field of plant molecular biology, and in particular relates to the separation and determination of a SCAR molecular marker for identifying the sex of Luo Han Guo. Background technique [0002] Mangosteen is a rare medicinal material. Traditional Chinese medicine believes that Luo Han Guo is sweet, sour, and cool in nature. [0003] Luo Han Guo is a dioecious plant, and the morphological characteristics of the male and female plants cannot be distinguished by the naked eye, and the male and female can only be distinguished when they bloom. At present, the seedlings used in actual production are almost all the cutting seedlings or tissue culture multiplication seedlings of female plants, and the seedlings propagated by seeds are rarely used. The advantages of cutting or tissue culture are that the operation is relatively simple and the effect is quick, but the cost of field, labor, and culture medium is still relatively hig...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor 张会新张继贤
Owner 怀化兴科创生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap